Bio-Roary v3.11.1 Perl 5 v5.14.4 x86_64-linux

Status
Fail
From
Serguei Trouchelle (STRO)
Dist
Bio-Roary v3.11.1
Platform
Perl 5 v5.14.4 x86_64-linux
Date
2018-01-12 13:16:57
ID
ddf6bfa4-f79a-11e7-a4c7-67516546f353
This distribution has been tested as part of the CPAN Testers
project, supporting the Perl programming language.  See
http://wiki.cpantesters.org/ for more information or email
questions to cpan-testers-discuss@perl.org


--
Dear Andrew Page,

This is a computer-generated report for Bio-Roary-3.11.1
on perl 5.14.4, created by CPAN-Reporter-1.2018.

Thank you for uploading your work to CPAN.  However, there was a problem
testing your distribution.

If you think this report is invalid, please consult the CPAN Testers Wiki
for suggestions on how to avoid getting FAIL reports for missing library
or binary dependencies, unsupported operating systems, and so on:

http://wiki.cpantesters.org/wiki/CPANAuthorNotes

Sections of this report:

    * Tester comments
    * Program output
    * Prerequisites
    * Environment and other context

------------------------------
TESTER COMMENTS
------------------------------

Additional comments from tester:

this report is from an automated smoke testing program
and was not reviewed by a human for accuracy

------------------------------
PROGRAM OUTPUT
------------------------------

Output from '/usr/bin/make test':

PERL_DL_NONLAZY=1 "/home/stro/perl/5.14.4/bin/perl" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(0, 'blib/lib', 'blib/arch')" t/*.t t/Bio/Roary/*.t t/Bio/Roary/CommandLine/*.t t/Bio/Roary/External/*.t t/Bio/Roary/Output/*.t t/Bio/Roary/QC/*.t
# 
# Versions for all modules listed in MYMETA.json (including optional ones):
# 
# === Configure Requires ===
# 
#     Module              Want Have
#     ------------------- ---- ----
#     ExtUtils::MakeMaker  any 7.30
# 
# === Build Requires ===
# 
#     Module              Want Have
#     ------------------- ---- ----
#     ExtUtils::MakeMaker  any 7.30
# 
# === Test Requires ===
# 
#     Module              Want     Have
#     ------------------- ---- --------
#     Data::Dumper         any    2.161
#     Env::Path            any     0.19
#     ExtUtils::MakeMaker  any     7.30
#     File::Spec           any     3.62
#     Test::Files          any     0.14
#     Test::More           any 1.302120
#     Test::Most           any     0.35
#     Test::Output         any    1.031
# 
# === Test Recommends ===
# 
#     Module         Want     Have
#     ---------- -------- --------
#     CPAN::Meta 2.120900 2.150010
# 
# === Runtime Requires ===
# 
#     Module              Want   Have
#     ------------------- ---- ------
#     Array::Utils         any    0.5
#     Bio::Perl            any  undef
#     Bio::SeqIO           any  undef
#     Bio::Tools::GFF      any  undef
#     Bio::TreeIO          any  undef
#     Cwd                  any   3.62
#     Digest::MD5::File    any   0.08
#     Exception::Class     any   1.43
#     File::Basename       any   2.82
#     File::Copy           any   2.21
#     File::Find::Rule     any   0.34
#     File::Grep           any   0.02
#     File::Path           any   2.15
#     File::Slurper        any  0.011
#     File::Spec           any   3.62
#     File::Temp           any 0.2304
#     File::Which          any   1.22
#     FindBin              any   1.50
#     Getopt::Long         any    2.5
#     Graph                any 0.9704
#     Graph::Writer::Dot   any   2.09
#     List::Util           any   1.49
#     Log::Log4perl        any   1.49
#     Moose                any 2.2009
#     Moose::Role          any 2.2009
#     POSIX                any   1.24
#     PerlIO::utf8_strict  any  0.007
#     Text::CSV            any   1.95
#     strict               any   1.04
#     warnings             any   1.12
# 
t/00-report-prereqs.t ................................... ok

#   Failed test 'blastp in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'makeblastdb in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'mcl in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'mcxdeblast in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'bedtools in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'prank in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'parallel in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'mafft in PATH'
#   at t/00_requires_external.t line 19.
# Looks like you failed 8 tests of 8.
t/00_requires_external.t ................................ 
Dubious, test returned 8 (wstat 2048, 0x800)
Failed 8/8 subtests 
t/author-00-compile.t ................................... skipped: these tests are for testing by the author
t/author-pod-syntax.t ................................... skipped: these tests are for testing by the author
t/Bio/Roary/AccessoryBinaryFasta.t ...................... ok
Cant open file: _accessory_clusters.clstr# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 2 just after 2.
t/Bio/Roary/AccessoryClustering.t ....................... 
Dubious, test returned 2 (wstat 512, 0x200)
All 2 subtests passed 
t/Bio/Roary/AnalyseGroups.t ............................. ok
t/Bio/Roary/AnnotateGroups.t ............................ ok
t/Bio/Roary/AssemblyStatistics.t ........................ ok
t/Bio/Roary/ChunkFastaFile.t ............................ ok
t/Bio/Roary/CombinedProteome.t .......................... ok

#   Failed test 'Actual output file exists example_annotation.gff.proteome.faa  -t 1 t/data/example_annotation.gff'
#   at t/lib/TestHelper.pm line 139.

#   Failed test 'Actual and expected output match for '-t 1 t/data/example_annotation.gff''
#   at t/lib/TestHelper.pm line 148.
# example_annotation.gff.proteome.faa absent

#   Failed test 'Actual output file exists example_annotation.gff.proteome.faa  t/data/example_annotation.gff'
#   at t/lib/TestHelper.pm line 139.

#   Failed test 'Actual and expected output match for 't/data/example_annotation.gff''
#   at t/lib/TestHelper.pm line 148.
# example_annotation.gff.proteome.faa absent
# Looks like you failed 4 tests of 7.
t/Bio/Roary/CommandLine/ExtractProteomeFromGff.t ........ 
Dubious, test returned 4 (wstat 1024, 0x400)
Failed 4/7 subtests 
t/Bio/Roary/CommandLine/GeneAlignmentFromNucleotides.t .. ok
t/Bio/Roary/CommandLine/ParallelAllAgainstAllBlastp.t ... ok
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.
grep: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EOpaK5QFzy/query_1.gff.proteome.faa: No such file or directory
grep: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EOpaK5QFzy/query_2.gff.proteome.faa: No such file or directory
grep: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EOpaK5QFzy/query_3.gff.proteome.faa: No such file or directory
grep: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EOpaK5QFzy/query_1.gff.proteome.faa: No such file or directory
grep: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EOpaK5QFzy/query_2.gff.proteome.faa: No such file or directory
grep: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EOpaK5QFzy/query_3.gff.proteome.faa: No such file or directory
grep: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EOpaK5QFzy/query_1.gff.proteome.faa: No such file or directory
grep: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EOpaK5QFzy/query_2.gff.proteome.faa: No such file or directory
grep: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EOpaK5QFzy/query_3.gff.proteome.faa: No such file or directory
grep: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EOpaK5QFzy/query_1.gff.proteome.faa: No such file or directory
grep: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EOpaK5QFzy/query_2.gff.proteome.faa: No such file or directory
grep: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EOpaK5QFzy/query_3.gff.proteome.faa: No such file or directory

#   Failed test 'Actual and expected sorted output match for '-g t/data/query_groups -a difference   -i t/data/query_1.gff -t t/data/query_2.gff,t/data/query_3.gff''
#   at t/lib/TestHelper.pm line 38.
#     Structures begin differing at:
#          $got->[1] = Does not exist
#     $expected->[1] = ARRAY(0x428e120)
# Looks like you failed 1 test of 37.
t/Bio/Roary/CommandLine/QueryRoary.t .................... 
Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/37 subtests 
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/bin/extract_proteome_from_gff line 12.
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/bin/extract_proteome_from_gff line 12.
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/bin/extract_proteome_from_gff line 12.

#   Failed test 'Actual output file exists gene_presence_absence.csv   -j Local -t 1 --dont_split_groups t/data/genbank_gbff/genbank1.gff t/data/genbank_gbff/genbank2.gff t/data/genbank_gbff/genbank3.gff'
#   at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib/TestHelper.pm line 249.
# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 2 just after 3.
t/Bio/Roary/CommandLine/Roary.t ......................... 
Dubious, test returned 2 (wstat 512, 0x200)
Failed 1/3 subtests 
t/Bio/Roary/CommandLine/RoaryCoreAlignment.t ............ ok
t/Bio/Roary/CommandLine/RoaryPostAnalysis.t ............. ok
t/Bio/Roary/CommandLine/RoaryReorderSpreadsheet.t ....... ok
t/Bio/Roary/CommandLine/TransferAnnotationToGroups.t .... ok
t/Bio/Roary/ContigsToGeneIDsFromGFF.t ................... ok
t/Bio/Roary/EmblGroups.t ................................ ok
t/Bio/Roary/External/Blastp.t ........................... ok
t/Bio/Roary/External/Cdhit.t ............................ ok

#   Failed test 'Check for parallel'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/01/12 04:13:27 ERROR: Can't find required 'parallel' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'parallel' - found )
# as expected

#   Failed test 'Check for blastp'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/01/12 04:13:27 ERROR: Can't find required 'blastp' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'blastp' - found )
# as expected

#   Failed test 'Check for makeblastdb'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/01/12 04:13:27 ERROR: Can't find required 'makeblastdb' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'makeblastdb' - found )
# as expected

#   Failed test 'Check for mcl'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/01/12 04:13:27 ERROR: Can't find required 'mcl' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'mcl' - found )
# as expected

#   Failed test 'Check for bedtools'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/01/12 04:13:27 ERROR: Can't find required 'bedtools' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'bedtools' - found )
# as expected

#   Failed test 'Check for prank'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/01/12 04:13:27 Optional tool 'prank' not found in your $PATH
# 
# doesn't match:
# (?^:Looking for 'prank' - found )
# as expected

#   Failed test 'Check for mafft'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/01/12 04:13:27 ERROR: Can't find required 'mafft' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'mafft' - found )
# as expected
# Looks like you failed 7 tests of 13.
t/Bio/Roary/External/CheckTools.t ....................... 
Dubious, test returned 7 (wstat 1792, 0x700)
Failed 7/13 subtests 
sh: 1: mafft: not found

#   Failed test 'output for mafft matches'
#   at t/Bio/Roary/External/Mafft.t line 39.
# +---+-----+---+-----------------------------------------------------------------------------+
# |   |Got  |   |Expected                                                                     |
# | Ln|     | Ln|                                                                             |
# +---+-----+---+-----------------------------------------------------------------------------+
# |   |     *  1|>1111#5_04506                                                                *
# |   |     *  2|------------------------------------------------------------                 *
# |   |     *  3|------------------------------------------------------------                 *
# |   |     *  4|------------------------------------------------------------                 *
# |   |     *  5|------------------------------------------------------------                 *
# |   |     *  6|------------------------------------------------------------                 *
# |   |     *  7|------------------------------------------------------------                 *
# |   |     *  8|------------------------------------------------------------                 *
# |   |     *  9|---------atggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg                 *
# |   |     * 10|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 11|attgataataaagttcaaccgcttatcaggcgttga                                         *
# |   |     * 12|>1234_8#75_04759                                                             *
# |   |     * 13|atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa                 *
# |   |     * 14|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat                 *
# |   |     * 15|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg                 *
# |   |     * 16|ctggattctttccggcgggatagtgctttttatacctggttgtatcgtattgcggtcaat                 *
# |   |     * 17|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg                 *
# |   |     * 18|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac                 *
# |   |     * 19|ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa                 *
# |   |     * 20|gatttacgtatggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg                 *
# |   |     * 21|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 22|attgataataaagttcaaccgcttatcaggcgttga                                         *
# |   |     * 23|>Salmonella_enterica_subsp_enterica_serovar_Typhimurium_DT104_v1_02853       *
# |   |     * 24|atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa                 *
# |   |     * 25|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat                 *
# |   |     * 26|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg                 *
# |   |     * 27|ctggattctttccggggggatagtgctttttatacctggttgtatcgtattgcggtcaat                 *
# |   |     * 28|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg                 *
# |   |     * 29|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac                 *
# |   |     * 30|ttaatgttttcagaagaactgagacagatagttttccgaactattgagtccctcccggaa                 *
# |   |     * 31|gatttacgtatggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg                 *
# |   |     * 32|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 33|attgataataaagttcaaccgcttatcaggcgttga                                         *
# |   |     * 34|>Salmonella_enterica_subsp_enterica_serovar_Typhimurium_SL1344_v2_02736      *
# |   |     * 35|atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa                 *
# |   |     * 36|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat                 *
# |   |     * 37|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg                 *
# |   |     * 38|ctggattctttccggggggatagtgctttttatacctggttgtatcgtattgcggtcaat                 *
# |   |     * 39|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg                 *
# |   |     * 40|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac                 *
# |   |     * 41|ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa                 *
# |   |     * 42|gatttacgtatggcaatcaccttacgggagctggatggcctgagctgtgaagagatagcg                 *
# |   |     * 43|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 44|attgataataaagttcaaccgcttatcaggcgttga                                         *
# |   |     * 45|>Salmonella_enterica_subsp_enterica_serovar_Typhimurium_str_D23580_v1_02783  *
# |   |     * 46|atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa                 *
# |   |     * 47|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat                 *
# |   |     * 48|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg                 *
# |   |     * 49|ctggattctttccggggggatagtgctttttatacctggttgtatcgtattgcggtcaat                 *
# |   |     * 50|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg                 *
# |   |     * 51|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac                 *
# |   |     * 52|ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa                 *
# |   |     * 53|gatttacgtatggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg                 *
# |   |     * 54|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 55|attgataataaagttcaaccgcttatcaggcgttga                                         *
# |   |     * 56|>Salmonella_enterica_subsp_enterica_serovar_Typhimurium_str_DT2_v1_02741     *
# |   |     * 57|atgagcgagcagttaacggac---gtcctggttgaacgggtccagaagggagatcagaaa                 *
# |   |     * 58|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat                 *
# |   |     * 59|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg                 *
# |   |     * 60|ctggattctttccggggggatagtgctttttatacctggttgtatcgtattgcggtcaat                 *
# |   |     * 61|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg                 *
# |   |     * 62|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac                 *
# |   |     * 63|ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa                 *
# |   |     * 64|gatttacgtatggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg                 *
# |   |     * 65|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 66|attgataataaagttcaaccgcttatcaggcgttga                                         *
# +---+-----+---+-----------------------------------------------------------------------------+
# Looks like you failed 1 test of 6.
t/Bio/Roary/External/Mafft.t ............................ 
Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/6 subtests 
t/Bio/Roary/External/Makeblastdb.t ...................... ok
2018/01/12 04:13:28 Cannot find the mcxdeblast executable, please ensure its in your PATH
# Tests were run but no plan was declared and done_testing() was not seen.
t/Bio/Roary/External/Mcl.t .............................. 
Dubious, test returned 254 (wstat 65024, 0xfe00)
All 5 subtests passed 

#   Failed test 'output file exists'
#   at t/Bio/Roary/External/Prank.t line 33.

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file 't/data/prank_input.fa.aln': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/stro/perl/5.14.4/lib/site_perl/5.14.4/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/stro/perl/5.14.4/lib/site_perl/5.14.4/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/stro/perl/5.14.4/lib/site_perl/5.14.4/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/stro/perl/5.14.4/lib/site_perl/5.14.4/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/stro/perl/5.14.4/lib/site_perl/5.14.4/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/stro/perl/5.14.4/lib/site_perl/5.14.4/Bio/SeqIO.pm:435
STACK: Bio::Roary::SortFasta::_input_seqio /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib/Bio/Roary/SortFasta.pm:27
STACK: Bio::Roary::SortFasta::sort_fasta /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib/Bio/Roary/SortFasta.pm:68
STACK: t/Bio/Roary/External/Prank.t:38
-----------------------------------------------------------
# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 2 just after 5.
t/Bio/Roary/External/Prank.t ............................ 
Dubious, test returned 2 (wstat 512, 0x200)
Failed 1/5 subtests 
t/Bio/Roary/ExtractCoreGenesFromSpreadsheet.t ........... ok
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.

#   Failed test 'content of proteome 1 as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 30.
# /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/30zzMcgCar/example_annotation.gff.proteome.faa absent
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.

#   Failed test 'content of proteome 1 as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 44.
# /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/cgCuRtnDzd/example_annotation_2.gff.proteome.faa absent
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.

#   Failed test 'content of proteome /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/6MaXufCCi8/genbank1.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 64.
# /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/6MaXufCCi8/genbank1.gff.proteome.faa absent

#   Failed test 'content of proteome /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/6MaXufCCi8/genbank2.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 64.
# /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/6MaXufCCi8/genbank2.gff.proteome.faa absent

#   Failed test 'content of proteome /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/6MaXufCCi8/genbank3.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 64.
# /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/6MaXufCCi8/genbank3.gff.proteome.faa absent
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.

#   Failed test 'content of proteome /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EhV6qH23K3/query_1.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 87.
# /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EhV6qH23K3/query_1.gff.proteome.faa absent

#   Failed test 'content of proteome /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EhV6qH23K3/query_2.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 87.
# /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EhV6qH23K3/query_2.gff.proteome.faa absent

#   Failed test 'content of proteome /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EhV6qH23K3/query_3.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 87.
# /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/EhV6qH23K3/query_3.gff.proteome.faa absent
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.

#   Failed test 'content of proteome /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/3pDDe8nAYn/annotation_1.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 112.
# /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/3pDDe8nAYn/annotation_1.gff.proteome.faa absent

#   Failed test 'content of proteome /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/3pDDe8nAYn/annotation_2.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 112.
# /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/3pDDe8nAYn/annotation_2.gff.proteome.faa absent
# Looks like you failed 10 tests of 20.
t/Bio/Roary/ExtractProteomeFromGFFs.t ................... 
Dubious, test returned 10 (wstat 2560, 0xa00)
Failed 10/20 subtests 
t/Bio/Roary/FilterFullClusters.t ........................ ok
t/Bio/Roary/GeneNamesFromGFF.t .......................... ok
t/Bio/Roary/GroupLabels.t ............................... ok
t/Bio/Roary/GroupStatistics.t ........................... ok
t/Bio/Roary/InflateClusters.t ........................... ok
t/Bio/Roary/OrderGenes.t ................................ ok
t/Bio/Roary/Output/CoreGeneAlignmentCoorindatesEMBL.t ... ok
t/Bio/Roary/Output/DifferenceBetweenSets.t .............. ok
t/Bio/Roary/Output/GroupsMultifastaProtein.t ............ ok
t/Bio/Roary/Output/GroupsMultifastas.t .................. ok
Attribute (fasta_file) does not pass the type constraint because: Validation failed for 'Str' with value undef at reader Bio::Roary::Output::GroupsMultifastaNucleotide::fasta_file (defined at lib/Bio/Roary/Output/GroupsMultifastaNucleotide.pm line 29) line 15
	Bio::Roary::Output::GroupsMultifastaNucleotide::fasta_file('Bio::Roary::Output::GroupsMultifastaNucleotide=HASH(0x35a1298)') called at lib/Bio/Roary/Output/GroupsMultifastaNucleotide.pm line 43
	Bio::Roary::Output::GroupsMultifastaNucleotide::_build__input_seqio('Bio::Roary::Output::GroupsMultifastaNucleotide=HASH(0x35a1298)') called at reader Bio::Roary::Output::GroupsMultifastaNucleotide::_input_seqio (defined at lib/Bio/Roary/Output/GroupsMultifastaNucleotide.pm line 30) line 7
	Bio::Roary::Output::GroupsMultifastaNucleotide::_input_seqio('Bio::Roary::Output::GroupsMultifastaNucleotide=HASH(0x35a1298)') called at lib/Bio/Roary/Output/GroupsMultifastaNucleotide.pm line 53
	Bio::Roary::Output::GroupsMultifastaNucleotide::populate_files('Bio::Roary::Output::GroupsMultifastaNucleotide=HASH(0x35a1298)') called at lib/Bio/Roary/Output/GroupsMultifastasNucleotide.pm line 65
	Bio::Roary::Output::GroupsMultifastasNucleotide::create_files('Bio::Roary::Output::GroupsMultifastasNucleotide=HASH(0x331ce78)') called at t/Bio/Roary/Output/GroupsMultifastasNucleotide.t line 40
# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 127 just after 3.
t/Bio/Roary/Output/GroupsMultifastasNucleotide.t ........ 
Dubious, test returned 127 (wstat 32512, 0x7f00)
All 3 subtests passed 
t/Bio/Roary/Output/NumberOfGroups.t ..................... ok
t/Bio/Roary/Output/QueryGroups.t ........................ ok
t/Bio/Roary/ParallelAllAgainstAllBlast.t ................ ok
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/t/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/lib /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/blib/arch /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.20.2 /usr/local/share/perl/5.20.2 /usr/lib/x86_64-linux-gnu/perl5/5.20 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.20 /usr/share/perl/5.20 /usr/local/lib/site_perl .) at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm line 7.
Compilation failed in require at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
BEGIN failed--compilation aborted at /home/stro/cpan/build/5.14.4/build/Bio-Roary-3.11.1-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 9.
Compilation failed in require at ./bin/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at ./bin/extract_proteome_from_gff line 12.
t/Bio/Roary/PrepareInputFiles.t ......................... ok
t/Bio/Roary/PresenceAbsenceMatrix.t ..................... ok
t/Bio/Roary/QC/Report.t ................................. ok
2018/01/12 04:13:38 Input file contains duplicate gene IDs, attempting to fix by adding a unique suffix, new GFF in the fixed_input_files directory: t/data/reformat_input_gffs/query_2.gff 
2018/01/12 04:13:38 Input file contains duplicate gene IDs, attempting to fix by adding a unique suffix, new GFF in the fixed_input_files directory: t/data/reformat_input_gffs/query_2.gff 
t/Bio/Roary/ReformatInputGFFs.t ......................... ok
t/Bio/Roary/ReorderSpreadsheet.t ........................ ok
t/Bio/Roary/SampleOrder.t ............................... ok
t/Bio/Roary/SequenceLengths.t ........................... ok
t/Bio/Roary/SortFasta.t ................................. ok
t/Bio/Roary/SplitGroups.t ............................... ok
t/Bio/Roary/UniqueGenesPerSample.t ...................... ok

Test Summary Report
-------------------
t/00_requires_external.t                              (Wstat: 2048 Tests: 8 Failed: 8)
  Failed tests:  1-8
  Non-zero exit status: 8
t/Bio/Roary/AccessoryClustering.t                     (Wstat: 512 Tests: 2 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Bio/Roary/CommandLine/ExtractProteomeFromGff.t      (Wstat: 1024 Tests: 7 Failed: 4)
  Failed tests:  4-7
  Non-zero exit status: 4
t/Bio/Roary/CommandLine/QueryRoary.t                  (Wstat: 256 Tests: 37 Failed: 1)
  Failed test:  27
  Non-zero exit status: 1
t/Bio/Roary/CommandLine/Roary.t                       (Wstat: 512 Tests: 3 Failed: 1)
  Failed test:  3
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Bio/Roary/External/CheckTools.t                     (Wstat: 1792 Tests: 13 Failed: 7)
  Failed tests:  3-9
  Non-zero exit status: 7
t/Bio/Roary/External/Mafft.t                          (Wstat: 256 Tests: 6 Failed: 1)
  Failed test:  6
  Non-zero exit status: 1
t/Bio/Roary/External/Mcl.t                            (Wstat: 65024 Tests: 5 Failed: 0)
  Non-zero exit status: 254
  Parse errors: No plan found in TAP output
t/Bio/Roary/External/Prank.t                          (Wstat: 512 Tests: 5 Failed: 1)
  Failed test:  5
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Bio/Roary/ExtractProteomeFromGFFs.t                 (Wstat: 2560 Tests: 20 Failed: 10)
  Failed tests:  4, 6, 9-11, 14-16, 19-20
  Non-zero exit status: 10
t/Bio/Roary/Output/GroupsMultifastasNucleotide.t      (Wstat: 32512 Tests: 3 Failed: 0)
  Non-zero exit status: 127
  Parse errors: No plan found in TAP output
Files=55, Tests=676, 27 wallclock secs ( 0.18 usr  0.02 sys + 18.76 cusr  1.04 csys = 20.00 CPU)
Result: FAIL
Failed 11/55 test programs. 33/676 subtests failed.
Makefile:1117: recipe for target 'test_dynamic' failed
make: *** [test_dynamic] Error 255

------------------------------
PREREQUISITES
------------------------------

Prerequisite modules loaded:

requires:

    Module              Need     Have    
    ------------------- -------- --------
    Array::Utils        0        0.5     
    Bio::Perl           0        1.007002
    Bio::SeqIO          0        0       
    Bio::Tools::GFF     0        0       
    Bio::TreeIO         0        1.007002
    Cwd                 0        3.62    
    Digest::MD5::File   0        0.08    
    Exception::Class    0        1.43    
    File::Basename      0        2.82    
    File::Copy          0        2.21    
    File::Find::Rule    0        0.34    
    File::Grep          0        0.02    
    File::Path          0        2.15    
    File::Slurper       0        0.011   
    File::Spec          0        3.62    
    File::Temp          0        0.2304  
    File::Which         0        1.22    
    FindBin             0        1.50    
    Getopt::Long        0        2.5     
    Graph               0        0.9704  
    Graph::Writer::Dot  0        2.09    
    List::Util          0        1.49    
    Log::Log4perl       0        1.49    
    Moose               0        2.2009  
    Moose::Role         0        2.2009  
    PerlIO::utf8_strict 0        0.007   
    POSIX               0        1.24    
    strict              0        1.04    
    Text::CSV           0        1.95    
    warnings            0        1.12    

build_requires:

    Module              Need     Have    
    ------------------- -------- --------
    Data::Dumper        0        2.161   
    Env::Path           0        0.19    
    ExtUtils::MakeMaker 0        7.30    
    File::Spec          0        3.62    
    Test::Files         0        0.14    
    Test::More          0        1.302120
    Test::Most          0        0.35    
    Test::Output        0        1.031   

configure_requires:

    Module              Need     Have    
    ------------------- -------- --------
    ExtUtils::MakeMaker 0        7.30    

opt_build_requires:

    Module              Need     Have    
    ------------------- -------- --------
    CPAN::Meta          2.120900 2.150010


------------------------------
ENVIRONMENT AND OTHER CONTEXT
------------------------------

Environment variables:

    AUTOMATED_TESTING = 1
    LANG = en_US.UTF-8
    PATH = /usr/local/bin:/usr/bin:/bin:/usr/local/games:/usr/games
    PERL5LIB = 
    PERL5OPT = 
    PERL5_CPANPLUS_IS_RUNNING = 672
    PERL5_CPAN_IS_RUNNING = 672
    PERL5_CPAN_IS_RUNNING_IN_RECURSION = 23891,672
    PERL_CR_SMOKER_CURRENT = Bio-Roary-3.11.1
    PERL_EXTUTILS_AUTOINSTALL = --defaultdeps
    PERL_MM_USE_DEFAULT = 1
    SHELL = /bin/bash
    TERM = xterm

Perl special variables (and OS-specific diagnostics, for MSWin32):

    $^X = /home/stro/perl/5.14.4/bin/perl
    $UID/$EUID = 1000 / 1000
    $GID = 1000 24 25 29 30 44 46 108 114 1000
    $EGID = 1000 24 25 29 30 44 46 108 114 1000

Perl module toolchain versions installed:

    Module              Have    
    ------------------- --------
    CPAN                2.16    
    CPAN::Meta          2.150010
    Cwd                 3.62    
    ExtUtils::CBuilder  0.280226
    ExtUtils::Command   7.30    
    ExtUtils::Install   2.06    
    ExtUtils::MakeMaker 7.30    
    ExtUtils::Manifest  1.70    
    ExtUtils::ParseXS   3.35    
    File::Spec          3.62    
    JSON                2.97001 
    JSON::PP            2.97001 
    Module::Build       0.4224  
    Module::Signature   0.81    
    Parse::CPAN::Meta   2.150010
    Test::Harness       3.39    
    Test::More          1.302120
    YAML                1.23    
    YAML::Syck          1.30    
    version             0.9918  


--

Summary of my perl5 (revision 5 version 14 subversion 4) configuration:
   
  Platform:
    osname=linux, osvers=3.16.0-4-amd64, archname=x86_64-linux
    uname='linux vm-debian-001 3.16.0-4-amd64 #1 smp debian 3.16.7-ckt11-1 (2015-05-24) x86_64 gnulinux '
    config_args=''
    hint=recommended, useposix=true, d_sigaction=define
    useithreads=undef, usemultiplicity=undef
    useperlio=define, d_sfio=undef, uselargefiles=define, usesocks=undef
    use64bitint=define, use64bitall=define, uselongdouble=undef
    usemymalloc=n, bincompat5005=undef
  Compiler:
    cc='cc', ccflags ='-fno-strict-aliasing -pipe -fstack-protector -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64',
    optimize='-O2',
    cppflags='-fno-strict-aliasing -pipe -fstack-protector -I/usr/local/include'
    ccversion='', gccversion='4.9.2', gccosandvers=''
    intsize=4, longsize=8, ptrsize=8, doublesize=8, byteorder=12345678
    d_longlong=define, longlongsize=8, d_longdbl=define, longdblsize=16
    ivtype='long', ivsize=8, nvtype='double', nvsize=8, Off_t='off_t', lseeksize=8
    alignbytes=8, prototype=define
  Linker and Libraries:
    ld='cc', ldflags =' -fstack-protector -L/usr/local/lib'
    libpth=/usr/local/lib /lib/x86_64-linux-gnu /lib/../lib /usr/lib/x86_64-linux-gnu /usr/lib/../lib /lib /usr/lib
    libs=-lnsl -ldl -lm -lcrypt -lutil -lc
    perllibs=-lnsl -ldl -lm -lcrypt -lutil -lc
    libc=, so=so, useshrplib=false, libperl=libperl.a
    gnulibc_version='2.19'
  Dynamic Linking:
    dlsrc=dl_dlopen.xs, dlext=so, d_dlsymun=undef, ccdlflags='-Wl,-E'
    cccdlflags='-fPIC', lddlflags='-shared -O2 -L/usr/local/lib -fstack-protector'


Characteristics of this binary (from libperl): 
  Compile-time options: PERL_DONT_CREATE_GVSV PERL_MALLOC_WRAP
                        PERL_PRESERVE_IVUV USE_64_BIT_ALL USE_64_BIT_INT
                        USE_LARGE_FILES USE_PERLIO USE_PERL_ATOF
  Built under linux
  Compiled at Sep 30 2017 20:32:40
  %ENV:
    PERL5LIB=""
    PERL5OPT=""
    PERL5_CPANPLUS_IS_RUNNING="672"
    PERL5_CPAN_IS_RUNNING="672"
    PERL5_CPAN_IS_RUNNING_IN_RECURSION="23891,672"
    PERL_CR_SMOKER_CURRENT="Bio-Roary-3.11.1"
    PERL_EXTUTILS_AUTOINSTALL="--defaultdeps"
    PERL_MM_USE_DEFAULT="1"
  @INC:
    /home/stro/perl/5.14.4/lib/site_perl/5.14.4/x86_64-linux
    /home/stro/perl/5.14.4/lib/site_perl/5.14.4
    /home/stro/perl/5.14.4/lib/5.14.4/x86_64-linux
    /home/stro/perl/5.14.4/lib/5.14.4
    .