Bio-Roary v3.12.0 Perl 5 v5.24.3 OpenBSD.amd64-openbsd

Status
Fail
From
Alceu Rodrigues de Freitas Junior
Dist
Bio-Roary v3.12.0
Platform
Perl 5 v5.24.3 OpenBSD.amd64-openbsd
Date
2018-02-16 21:03:30
ID
d71a69be-135c-11e8-bba5-e41543cc1d2e
This distribution has been tested as part of the CPAN Testers
project, supporting the Perl programming language.  See
http://wiki.cpantesters.org/ for more information or email
questions to cpan-testers-discuss@perl.org


--
Dear Andrew Page,

This is a computer-generated report for Bio-Roary-3.12.0
on perl 5.24.3, created by CPAN-Reporter-1.2018.

Thank you for uploading your work to CPAN.  However, there was a problem
testing your distribution.

If you think this report is invalid, please consult the CPAN Testers Wiki
for suggestions on how to avoid getting FAIL reports for missing library
or binary dependencies, unsupported operating systems, and so on:

http://wiki.cpantesters.org/wiki/CPANAuthorNotes

Sections of this report:

    * Tester comments
    * Program output
    * Prerequisites
    * Environment and other context

------------------------------
TESTER COMMENTS
------------------------------

Additional comments from tester:

this report is from an automated smoke testing program
and was not reviewed by a human for accuracy

------------------------------
PROGRAM OUTPUT
------------------------------

Output from '/usr/bin/make test':

PERL_DL_NONLAZY=1 "/home/goku/perl5/perlbrew/perls/perl-5.24.3/bin/perl" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(0, 'blib/lib', 'blib/arch')" t/*.t t/Bio/Roary/*.t t/Bio/Roary/CommandLine/*.t t/Bio/Roary/External/*.t t/Bio/Roary/Output/*.t t/Bio/Roary/QC/*.t
# 
# Versions for all modules listed in MYMETA.json (including optional ones):
# 
# === Configure Requires ===
# 
#     Module              Want    Have
#     ------------------- ---- -------
#     ExtUtils::MakeMaker  any 7.31_08
# 
# === Build Requires ===
# 
#     Module              Want    Have
#     ------------------- ---- -------
#     ExtUtils::MakeMaker  any 7.31_08
# 
# === Test Requires ===
# 
#     Module              Want     Have
#     ------------------- ---- --------
#     Data::Dumper         any    2.161
#     Env::Path            any     0.19
#     ExtUtils::MakeMaker  any  7.31_08
#     File::Spec           any  3.63_01
#     Test::Files          any     0.14
#     Test::More           any 1.302122
#     Test::Most           any     0.35
#     Test::Output         any    1.031
# 
# === Test Recommends ===
# 
#     Module         Want     Have
#     ---------- -------- --------
#     CPAN::Meta 2.120900 2.150010
# 
# === Runtime Requires ===
# 
#     Module              Want    Have
#     ------------------- ---- -------
#     Array::Utils         any     0.5
#     Bio::Perl            any   undef
#     Bio::SeqIO           any   undef
#     Bio::Tools::GFF      any   undef
#     Bio::TreeIO          any   undef
#     Cwd                  any 3.63_01
#     Digest::MD5::File    any    0.08
#     Exception::Class     any    1.44
#     File::Basename       any    2.85
#     File::Copy           any    2.31
#     File::Find::Rule     any    0.34
#     File::Grep           any    0.02
#     File::Path           any 2.12_01
#     File::Slurper        any   0.011
#     File::Spec           any 3.63_01
#     File::Temp           any  0.2304
#     File::Which          any    1.22
#     FindBin              any    1.51
#     Getopt::Long         any    2.48
#     Graph                any  0.9704
#     Graph::Writer::Dot   any    2.09
#     List::Util           any    1.49
#     Log::Log4perl        any    1.49
#     Moose                any  2.2009
#     Moose::Role          any  2.2009
#     POSIX                any 1.65_01
#     PerlIO::utf8_strict  any   0.007
#     Text::CSV            any    1.95
#     strict               any    1.11
#     warnings             any    1.36
# 
t/00-report-prereqs.t ................................... ok

#   Failed test 'blastp in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'makeblastdb in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'mcl in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'mcxdeblast in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'bedtools in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'prank in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'mafft in PATH'
#   at t/00_requires_external.t line 19.
# Looks like you failed 7 tests of 8.
t/00_requires_external.t ................................ 
Dubious, test returned 7 (wstat 1792, 0x700)
Failed 7/8 subtests 
t/author-00-compile.t ................................... skipped: these tests are for testing by the author
t/author-pod-syntax.t ................................... skipped: these tests are for testing by the author
t/Bio/Roary/AccessoryBinaryFasta.t ...................... ok
Cant open file: _accessory_clusters.clstr# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 2 just after 2.
t/Bio/Roary/AccessoryClustering.t ....................... 
Dubious, test returned 2 (wstat 512, 0x200)
All 2 subtests passed 
t/Bio/Roary/AnalyseGroups.t ............................. ok
t/Bio/Roary/AnnotateGroups.t ............................ ok
t/Bio/Roary/AssemblyStatistics.t ........................ ok
t/Bio/Roary/ChunkFastaFile.t ............................ ok
t/Bio/Roary/CombinedProteome.t .......................... ok

#   Failed test 'Actual output file exists example_annotation.gff.proteome.faa  -t 1 t/data/example_annotation.gff'
#   at t/lib/TestHelper.pm line 139.

#   Failed test 'Actual and expected output match for '-t 1 t/data/example_annotation.gff''
#   at t/lib/TestHelper.pm line 148.
# example_annotation.gff.proteome.faa absent

#   Failed test 'Actual output file exists example_annotation.gff.proteome.faa  t/data/example_annotation.gff'
#   at t/lib/TestHelper.pm line 139.

#   Failed test 'Actual and expected output match for 't/data/example_annotation.gff''
#   at t/lib/TestHelper.pm line 148.
# example_annotation.gff.proteome.faa absent
# Looks like you failed 4 tests of 7.
t/Bio/Roary/CommandLine/ExtractProteomeFromGff.t ........ 
Dubious, test returned 4 (wstat 1024, 0x400)
Failed 4/7 subtests 
t/Bio/Roary/CommandLine/GeneAlignmentFromNucleotides.t .. ok
t/Bio/Roary/CommandLine/ParallelAllAgainstAllBlastp.t ... ok

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/ScwPeTJJbl/query_1.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/ScwPeTJJbl/query_2.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/ScwPeTJJbl/query_3.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------
grep: /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/ScwPeTJJbl/query_1.gff.proteome.faa: No such file or directory
grep: /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/ScwPeTJJbl/query_2.gff.proteome.faa: No such file or directory
grep: /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/ScwPeTJJbl/query_3.gff.proteome.faa: No such file or directory
grep: /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/ScwPeTJJbl/query_1.gff.proteome.faa: No such file or directory
grep: /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/ScwPeTJJbl/query_2.gff.proteome.faa: No such file or directory
grep: /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/ScwPeTJJbl/query_3.gff.proteome.faa: No such file or directory
grep: /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/ScwPeTJJbl/query_1.gff.proteome.faa: No such file or directory
grep: /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/ScwPeTJJbl/query_2.gff.proteome.faa: No such file or directory
grep: /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/ScwPeTJJbl/query_3.gff.proteome.faa: No such file or directory
grep: /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/ScwPeTJJbl/query_1.gff.proteome.faa: No such file or directory
grep: /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/ScwPeTJJbl/query_2.gff.proteome.faa: No such file or directory
grep: /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/ScwPeTJJbl/query_3.gff.proteome.faa: No such file or directory

#   Failed test 'Actual and expected sorted output match for '-g t/data/query_groups -a difference   -i t/data/query_1.gff -t t/data/query_2.gff,t/data/query_3.gff''
#   at t/lib/TestHelper.pm line 38.
#     Structures begin differing at:
#          $got->[1] = Does not exist
#     $expected->[1] = ARRAY(0xc68cb550a0)
# Looks like you failed 1 test of 37.
t/Bio/Roary/CommandLine/QueryRoary.t .................... 
Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/37 subtests 

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/1NNq3rPGTu/genbank1.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/bin/extract_proteome_from_gff:14
-----------------------------------------------------------

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/1NNq3rPGTu/genbank2.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/bin/extract_proteome_from_gff:14
-----------------------------------------------------------

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/1NNq3rPGTu/genbank3.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/bin/extract_proteome_from_gff:14
-----------------------------------------------------------

#   Failed test 'Actual output file exists gene_presence_absence.csv   -j Local -t 1 --dont_split_groups t/data/genbank_gbff/genbank1.gff t/data/genbank_gbff/genbank2.gff t/data/genbank_gbff/genbank3.gff'
#   at /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/t/lib/TestHelper.pm line 249.
# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 2 just after 3.
t/Bio/Roary/CommandLine/Roary.t ......................... 
Dubious, test returned 2 (wstat 512, 0x200)
Failed 1/3 subtests 
t/Bio/Roary/CommandLine/RoaryCoreAlignment.t ............ ok
t/Bio/Roary/CommandLine/RoaryPostAnalysis.t ............. ok
t/Bio/Roary/CommandLine/RoaryReorderSpreadsheet.t ....... ok
t/Bio/Roary/CommandLine/TransferAnnotationToGroups.t .... ok
t/Bio/Roary/ContigsToGeneIDsFromGFF.t ................... ok
t/Bio/Roary/EmblGroups.t ................................ ok
t/Bio/Roary/External/Blastp.t ........................... ok
t/Bio/Roary/External/Cdhit.t ............................ ok

#   Failed test 'Check for blastp'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/02/16 08:19:58 ERROR: Can't find required 'blastp' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'blastp' - found )
# as expected

#   Failed test 'Check for makeblastdb'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/02/16 08:19:58 ERROR: Can't find required 'makeblastdb' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'makeblastdb' - found )
# as expected

#   Failed test 'Check for mcl'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/02/16 08:19:58 ERROR: Can't find required 'mcl' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'mcl' - found )
# as expected

#   Failed test 'Check for bedtools'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/02/16 08:19:58 ERROR: Can't find required 'bedtools' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'bedtools' - found )
# as expected

#   Failed test 'Check for prank'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/02/16 08:19:58 Optional tool 'prank' not found in your $PATH
# 
# doesn't match:
# (?^:Looking for 'prank' - found )
# as expected

#   Failed test 'Check for mafft'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/02/16 08:19:58 ERROR: Can't find required 'mafft' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'mafft' - found )
# as expected
# Looks like you failed 6 tests of 13.
t/Bio/Roary/External/CheckTools.t ....................... 
Dubious, test returned 6 (wstat 1536, 0x600)
Failed 6/13 subtests 
sh: mafft: not found

#   Failed test 'output for mafft matches'
#   at t/Bio/Roary/External/Mafft.t line 39.
# +---+-----+---+-----------------------------------------------------------------------------+
# |   |Got  |   |Expected                                                                     |
# | Ln|     | Ln|                                                                             |
# +---+-----+---+-----------------------------------------------------------------------------+
# |   |     *  1|>1111#5_04506                                                                *
# |   |     *  2|------------------------------------------------------------                 *
# |   |     *  3|------------------------------------------------------------                 *
# |   |     *  4|------------------------------------------------------------                 *
# |   |     *  5|------------------------------------------------------------                 *
# |   |     *  6|------------------------------------------------------------                 *
# |   |     *  7|------------------------------------------------------------                 *
# |   |     *  8|------------------------------------------------------------                 *
# |   |     *  9|---------atggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg                 *
# |   |     * 10|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 11|attgataataaagttcaaccgcttatcaggcgttga                                         *
# |   |     * 12|>1234_8#75_04759                                                             *
# |   |     * 13|atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa                 *
# |   |     * 14|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat                 *
# |   |     * 15|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg                 *
# |   |     * 16|ctggattctttccggcgggatagtgctttttatacctggttgtatcgtattgcggtcaat                 *
# |   |     * 17|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg                 *
# |   |     * 18|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac                 *
# |   |     * 19|ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa                 *
# |   |     * 20|gatttacgtatggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg                 *
# |   |     * 21|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 22|attgataataaagttcaaccgcttatcaggcgttga                                         *
# |   |     * 23|>Salmonella_enterica_subsp_enterica_serovar_Typhimurium_DT104_v1_02853       *
# |   |     * 24|atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa                 *
# |   |     * 25|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat                 *
# |   |     * 26|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg                 *
# |   |     * 27|ctggattctttccggggggatagtgctttttatacctggttgtatcgtattgcggtcaat                 *
# |   |     * 28|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg                 *
# |   |     * 29|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac                 *
# |   |     * 30|ttaatgttttcagaagaactgagacagatagttttccgaactattgagtccctcccggaa                 *
# |   |     * 31|gatttacgtatggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg                 *
# |   |     * 32|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 33|attgataataaagttcaaccgcttatcaggcgttga                                         *
# |   |     * 34|>Salmonella_enterica_subsp_enterica_serovar_Typhimurium_SL1344_v2_02736      *
# |   |     * 35|atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa                 *
# |   |     * 36|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat                 *
# |   |     * 37|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg                 *
# |   |     * 38|ctggattctttccggggggatagtgctttttatacctggttgtatcgtattgcggtcaat                 *
# |   |     * 39|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg                 *
# |   |     * 40|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac                 *
# |   |     * 41|ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa                 *
# |   |     * 42|gatttacgtatggcaatcaccttacgggagctggatggcctgagctgtgaagagatagcg                 *
# |   |     * 43|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 44|attgataataaagttcaaccgcttatcaggcgttga                                         *
# |   |     * 45|>Salmonella_enterica_subsp_enterica_serovar_Typhimurium_str_D23580_v1_02783  *
# |   |     * 46|atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa                 *
# |   |     * 47|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat                 *
# |   |     * 48|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg                 *
# |   |     * 49|ctggattctttccggggggatagtgctttttatacctggttgtatcgtattgcggtcaat                 *
# |   |     * 50|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg                 *
# |   |     * 51|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac                 *
# |   |     * 52|ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa                 *
# |   |     * 53|gatttacgtatggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg                 *
# |   |     * 54|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 55|attgataataaagttcaaccgcttatcaggcgttga                                         *
# |   |     * 56|>Salmonella_enterica_subsp_enterica_serovar_Typhimurium_str_DT2_v1_02741     *
# |   |     * 57|atgagcgagcagttaacggac---gtcctggttgaacgggtccagaagggagatcagaaa                 *
# |   |     * 58|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat                 *
# |   |     * 59|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg                 *
# |   |     * 60|ctggattctttccggggggatagtgctttttatacctggttgtatcgtattgcggtcaat                 *
# |   |     * 61|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg                 *
# |   |     * 62|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac                 *
# |   |     * 63|ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa                 *
# |   |     * 64|gatttacgtatggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg                 *
# |   |     * 65|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 66|attgataataaagttcaaccgcttatcaggcgttga                                         *
# +---+-----+---+-----------------------------------------------------------------------------+
# Looks like you failed 1 test of 6.
t/Bio/Roary/External/Mafft.t ............................ 
Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/6 subtests 
t/Bio/Roary/External/Makeblastdb.t ...................... ok
2018/02/16 08:20:00 Cannot find the mcxdeblast executable, please ensure its in your PATH
# Tests were run but no plan was declared and done_testing() was not seen.
t/Bio/Roary/External/Mcl.t .............................. 
Dubious, test returned 254 (wstat 65024, 0xfe00)
All 5 subtests passed 

#   Failed test 'output file exists'
#   at t/Bio/Roary/External/Prank.t line 33.

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file 't/data/prank_input.fa.aln': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::SortFasta::_input_seqio /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/blib/lib/Bio/Roary/SortFasta.pm:27
STACK: Bio::Roary::SortFasta::sort_fasta /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/blib/lib/Bio/Roary/SortFasta.pm:68
STACK: t/Bio/Roary/External/Prank.t:38
-----------------------------------------------------------
# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 2 just after 5.
t/Bio/Roary/External/Prank.t ............................ 
Dubious, test returned 2 (wstat 512, 0x200)
Failed 1/5 subtests 
t/Bio/Roary/ExtractCoreGenesFromSpreadsheet.t ........... ok

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/dE7NlJpiFh/example_annotation.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/dE7NlJpiFh/example_annotation_2.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------

#   Failed test 'content of proteome 1 as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 30.
# /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/dE7NlJpiFh/example_annotation.gff.proteome.faa absent

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/BY4eAdztFx/example_annotation_no_fasta_line.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/BY4eAdztFx/example_annotation_2.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------

#   Failed test 'content of proteome 1 as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 44.
# /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/BY4eAdztFx/example_annotation_2.gff.proteome.faa absent

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/h2AEl3tX36/genbank1.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/h2AEl3tX36/genbank2.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/h2AEl3tX36/genbank3.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------

#   Failed test 'content of proteome /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/h2AEl3tX36/genbank1.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 64.
# /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/h2AEl3tX36/genbank1.gff.proteome.faa absent

#   Failed test 'content of proteome /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/h2AEl3tX36/genbank2.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 64.
# /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/h2AEl3tX36/genbank2.gff.proteome.faa absent

#   Failed test 'content of proteome /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/h2AEl3tX36/genbank3.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 64.
# /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/h2AEl3tX36/genbank3.gff.proteome.faa absent

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/bnpS_Ph0iR/query_1.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/bnpS_Ph0iR/query_2.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/bnpS_Ph0iR/query_3.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------

#   Failed test 'content of proteome /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/bnpS_Ph0iR/query_1.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 87.
# /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/bnpS_Ph0iR/query_1.gff.proteome.faa absent

#   Failed test 'content of proteome /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/bnpS_Ph0iR/query_2.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 87.
# /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/bnpS_Ph0iR/query_2.gff.proteome.faa absent

#   Failed test 'content of proteome /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/bnpS_Ph0iR/query_3.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 87.
# /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/bnpS_Ph0iR/query_3.gff.proteome.faa absent

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lFSGoedq8a/annotation_1.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lFSGoedq8a/annotation_2.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------

#   Failed test 'content of proteome /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lFSGoedq8a/annotation_1.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 112.
# /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lFSGoedq8a/annotation_1.gff.proteome.faa absent

#   Failed test 'content of proteome /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lFSGoedq8a/annotation_2.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 112.
# /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lFSGoedq8a/annotation_2.gff.proteome.faa absent
# Looks like you failed 10 tests of 20.
t/Bio/Roary/ExtractProteomeFromGFFs.t ................... 
Dubious, test returned 10 (wstat 2560, 0xa00)
Failed 10/20 subtests 
t/Bio/Roary/FilterFullClusters.t ........................ ok
t/Bio/Roary/GeneNamesFromGFF.t .......................... ok
t/Bio/Roary/GroupLabels.t ............................... ok
t/Bio/Roary/GroupStatistics.t ........................... ok
t/Bio/Roary/InflateClusters.t ........................... ok
t/Bio/Roary/OrderGenes.t ................................ ok
t/Bio/Roary/Output/CoreGeneAlignmentCoorindatesEMBL.t ... ok
t/Bio/Roary/Output/DifferenceBetweenSets.t .............. ok
t/Bio/Roary/Output/GroupsMultifastaProtein.t ............ ok
t/Bio/Roary/Output/GroupsMultifastas.t .................. ok
Attribute (fasta_file) does not pass the type constraint because: Validation failed for 'Str' with value undef at reader Bio::Roary::Output::GroupsMultifastaNucleotide::fasta_file (defined at lib/Bio/Roary/Output/GroupsMultifastaNucleotide.pm line 29) line 15
	Bio::Roary::Output::GroupsMultifastaNucleotide::fasta_file('Bio::Roary::Output::GroupsMultifastaNucleotide=HASH(0x90f8d5b93e8)') called at lib/Bio/Roary/Output/GroupsMultifastaNucleotide.pm line 43
	Bio::Roary::Output::GroupsMultifastaNucleotide::_build__input_seqio('Bio::Roary::Output::GroupsMultifastaNucleotide=HASH(0x90f8d5b93e8)') called at reader Bio::Roary::Output::GroupsMultifastaNucleotide::_input_seqio (defined at lib/Bio/Roary/Output/GroupsMultifastaNucleotide.pm line 30) line 8
	Bio::Roary::Output::GroupsMultifastaNucleotide::_input_seqio('Bio::Roary::Output::GroupsMultifastaNucleotide=HASH(0x90f8d5b93e8)') called at lib/Bio/Roary/Output/GroupsMultifastaNucleotide.pm line 53
	Bio::Roary::Output::GroupsMultifastaNucleotide::populate_files('Bio::Roary::Output::GroupsMultifastaNucleotide=HASH(0x90f8d5b93e8)') called at lib/Bio/Roary/Output/GroupsMultifastasNucleotide.pm line 65
	Bio::Roary::Output::GroupsMultifastasNucleotide::create_files('Bio::Roary::Output::GroupsMultifastasNucleotide=HASH(0x90ef79e10d0)') called at t/Bio/Roary/Output/GroupsMultifastasNucleotide.t line 40
# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 127 just after 3.
t/Bio/Roary/Output/GroupsMultifastasNucleotide.t ........ 
Dubious, test returned 127 (wstat 32512, 0x7f00)
All 3 subtests passed 
t/Bio/Roary/Output/NumberOfGroups.t ..................... ok
t/Bio/Roary/Output/QueryGroups.t ........................ ok
t/Bio/Roary/ParallelAllAgainstAllBlast.t ................ ok

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/81Ic3loPUS/example_annotation.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Could not read file '/mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/81Ic3loPUS/example_annotation_2.gff.proteome.faa.intermediate.extracted.fa': No such file or directory
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/Root.pm:447
STACK: Bio::Root::IO::_initialize_io /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/Root/IO.pm:268
STACK: Bio::SeqIO::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:513
STACK: Bio::SeqIO::fasta::_initialize /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO/fasta.pm:87
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:389
STACK: Bio::SeqIO::new /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/Bio/SeqIO.pm:435
STACK: Bio::Roary::ExtractProteomeFromGFF::_fastatranslate /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:150
STACK: Bio::Roary::ExtractProteomeFromGFF::_convert_nucleotide_to_protein /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:164
STACK: Bio::Roary::ExtractProteomeFromGFF::fasta_file /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/ExtractProteomeFromGFF.pm:29
STACK: Bio::Roary::CommandLine::ExtractProteomeFromGff::run /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm:90
STACK: ./bin/extract_proteome_from_gff:14
-----------------------------------------------------------
t/Bio/Roary/PrepareInputFiles.t ......................... ok
t/Bio/Roary/PresenceAbsenceMatrix.t ..................... ok
t/Bio/Roary/QC/Report.t ................................. ok
2018/02/16 08:20:22 Input file contains duplicate gene IDs, attempting to fix by adding a unique suffix, new GFF in the fixed_input_files directory: t/data/reformat_input_gffs/query_2.gff 
2018/02/16 08:20:22 Input file contains duplicate gene IDs, attempting to fix by adding a unique suffix, new GFF in the fixed_input_files directory: t/data/reformat_input_gffs/query_2.gff 
t/Bio/Roary/ReformatInputGFFs.t ......................... ok
t/Bio/Roary/ReorderSpreadsheet.t ........................ ok
t/Bio/Roary/SampleOrder.t ............................... ok
t/Bio/Roary/SequenceLengths.t ........................... ok
t/Bio/Roary/SortFasta.t ................................. ok
t/Bio/Roary/SplitGroups.t ............................... ok
t/Bio/Roary/UniqueGenesPerSample.t ...................... ok

Test Summary Report
-------------------
t/00_requires_external.t                              (Wstat: 1792 Tests: 8 Failed: 7)
  Failed tests:  1-6, 8
  Non-zero exit status: 7
t/Bio/Roary/AccessoryClustering.t                     (Wstat: 512 Tests: 2 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Bio/Roary/CommandLine/ExtractProteomeFromGff.t      (Wstat: 1024 Tests: 7 Failed: 4)
  Failed tests:  4-7
  Non-zero exit status: 4
t/Bio/Roary/CommandLine/QueryRoary.t                  (Wstat: 256 Tests: 37 Failed: 1)
  Failed test:  27
  Non-zero exit status: 1
t/Bio/Roary/CommandLine/Roary.t                       (Wstat: 512 Tests: 3 Failed: 1)
  Failed test:  3
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Bio/Roary/External/CheckTools.t                     (Wstat: 1536 Tests: 13 Failed: 6)
  Failed tests:  4-9
  Non-zero exit status: 6
t/Bio/Roary/External/Mafft.t                          (Wstat: 256 Tests: 6 Failed: 1)
  Failed test:  6
  Non-zero exit status: 1
t/Bio/Roary/External/Mcl.t                            (Wstat: 65024 Tests: 5 Failed: 0)
  Non-zero exit status: 254
  Parse errors: No plan found in TAP output
t/Bio/Roary/External/Prank.t                          (Wstat: 512 Tests: 5 Failed: 1)
  Failed test:  5
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Bio/Roary/ExtractProteomeFromGFFs.t                 (Wstat: 2560 Tests: 20 Failed: 10)
  Failed tests:  4, 6, 9-11, 14-16, 19-20
  Non-zero exit status: 10
t/Bio/Roary/Output/GroupsMultifastasNucleotide.t      (Wstat: 32512 Tests: 3 Failed: 0)
  Non-zero exit status: 127
  Parse errors: No plan found in TAP output
Files=55, Tests=676, 51 wallclock secs ( 0.15 usr  0.34 sys + 27.48 cusr 20.16 csys = 48.13 CPU)
Result: FAIL
Failed 11/55 test programs. 31/676 subtests failed.
*** Error 255 in /mnt/cpan_build_dir/goku/Bio-Roary-3.12.0-0 (Makefile:1117 'test_dynamic')

------------------------------
PREREQUISITES
------------------------------

Prerequisite modules loaded:

requires:

    Module              Need     Have    
    ------------------- -------- --------
    Array::Utils        0        0.5     
    Bio::Perl           0        1.007002
    Bio::SeqIO          0        0       
    Bio::Tools::GFF     0        0       
    Bio::TreeIO         0        1.007002
    Cwd                 0        3.63_01 
    Digest::MD5::File   0        0.08    
    Exception::Class    0        1.44    
    File::Basename      0        2.85    
    File::Copy          0        2.31    
    File::Find::Rule    0        0.34    
    File::Grep          0        0.02    
    File::Path          0        2.12_01 
    File::Slurper       0        0.011   
    File::Spec          0        3.63_01 
    File::Temp          0        0.2304  
    File::Which         0        1.22    
    FindBin             0        1.51    
    Getopt::Long        0        2.48    
    Graph               0        0.9704  
    Graph::Writer::Dot  0        2.09    
    List::Util          0        1.49    
    Log::Log4perl       0        1.49    
    Moose               0        2.2009  
    Moose::Role         0        2.2009  
    PerlIO::utf8_strict 0        0.007   
    POSIX               0        1.65_01 
    strict              0        1.11    
    Text::CSV           0        1.95    
    warnings            0        1.36    

build_requires:

    Module              Need     Have    
    ------------------- -------- --------
    Data::Dumper        0        2.161   
    Env::Path           0        0.19    
    ExtUtils::MakeMaker 0        7.31_08 
    File::Spec          0        3.63_01 
    Test::Files         0        0.14    
    Test::More          0        1.302122
    Test::Most          0        0.35    
    Test::Output        0        1.031   

configure_requires:

    Module              Need     Have    
    ------------------- -------- --------
    ExtUtils::MakeMaker 0        7.31_08 

opt_build_requires:

    Module              Need     Have    
    ------------------- -------- --------
    CPAN::Meta          2.120900 2.150010


------------------------------
ENVIRONMENT AND OTHER CONTEXT
------------------------------

Environment variables:

    AUTOMATED_TESTING = 1
    DBD_MYSQL_TESTDB = test
    DBD_MYSQL_TESTHOST = localhost
    DBD_MYSQL_TESTPASSWORD = 
    DBD_MYSQL_TESTPORT = 3306
    DBD_MYSQL_TESTUSER = goku
    EXTENDED_TESTING = 1
    PATH = /home/goku/perl5/perlbrew/bin:/home/goku/perl5/perlbrew/perls/perl-5.24.3/bin:/home/goku/bin:/usr/bin:/bin:/usr/sbin:/sbin:/usr/X11R6/bin:/usr/local/bin:/usr/local/sbin
    PERL5LIB = 
    PERL5OPT = 
    PERL5_CPANPLUS_IS_RUNNING = 12876
    PERL5_CPAN_IS_RUNNING = 12876
    PERL5_CPAN_IS_RUNNING_IN_RECURSION = 87058,12876
    PERLBREW_HOME = /home/goku/.perlbrew
    PERLBREW_MANPATH = /home/goku/perl5/perlbrew/perls/perl-5.24.3/man
    PERLBREW_PATH = /home/goku/perl5/perlbrew/bin:/home/goku/perl5/perlbrew/perls/perl-5.24.3/bin
    PERLBREW_PERL = perl-5.24.3
    PERLBREW_ROOT = /home/goku/perl5/perlbrew
    PERLBREW_SHELLRC_VERSION = 0.82
    PERLBREW_VERSION = 0.82
    PERL_CR_SMOKER_CURRENT = Bio-Roary-3.12.0
    PERL_EXTUTILS_AUTOINSTALL = --defaultdeps
    PERL_MM_USE_DEFAULT = 1
    SHELL = /usr/local/bin/bash
    TERM = xterm

Perl special variables (and OS-specific diagnostics, for MSWin32):

    $^X = /home/goku/perl5/perlbrew/perls/perl-5.24.3/bin/perl
    $UID/$EUID = 1001 / 1001
    $GID = 998 998 1001
    $EGID = 998 998 1001

Perl module toolchain versions installed:

    Module              Have    
    ------------------- --------
    CPAN                2.16    
    CPAN::Meta          2.150010
    Cwd                 3.63_01 
    ExtUtils::CBuilder  0.280230
    ExtUtils::Command   7.31_08 
    ExtUtils::Install   2.06    
    ExtUtils::MakeMaker 7.31_08 
    ExtUtils::Manifest  1.70    
    ExtUtils::ParseXS   3.31    
    File::Spec          3.63_01 
    JSON                2.97001 
    JSON::PP            2.97001 
    Module::Build       0.4224  
    Module::Signature   n/a     
    Parse::CPAN::Meta   2.150010
    Test::Harness       3.39    
    Test::More          1.302122
    YAML                1.24    
    YAML::Syck          1.30    
    version             0.9916  


--

Summary of my perl5 (revision 5 version 24 subversion 3) configuration:
   
  Platform:
    osname=openbsd, osvers=6.2, archname=OpenBSD.amd64-openbsd
    uname='openbsd cpan-smoker-openbsd 6.2 generic.mp#134 amd64 '
    config_args='-de -Dprefix=/home/goku/perl5/perlbrew/perls/perl-5.24.3 -Aeval:scriptdir=/home/goku/perl5/perlbrew/perls/perl-5.24.3/bin'
    hint=recommended, useposix=true, d_sigaction=define
    useithreads=undef, usemultiplicity=undef
    use64bitint=define, use64bitall=define, uselongdouble=undef
    usemymalloc=n, bincompat5005=undef
  Compiler:
    cc='cc', ccflags ='-fno-strict-aliasing -pipe -fstack-protector-strong -I/usr/local/include -D_FORTIFY_SOURCE=2',
    optimize='-O2',
    cppflags='-fno-strict-aliasing -pipe -fstack-protector-strong -I/usr/local/include'
    ccversion='', gccversion='4.2.1 Compatible OpenBSD Clang 4.0.0 (tags/RELEASE_400/final)', gccosandvers=''
    intsize=4, longsize=8, ptrsize=8, doublesize=8, byteorder=12345678, doublekind=3
    d_longlong=define, longlongsize=8, d_longdbl=define, longdblsize=16, longdblkind=3
    ivtype='long', ivsize=8, nvtype='double', nvsize=8, Off_t='off_t', lseeksize=8
    alignbytes=8, prototype=define
  Linker and Libraries:
    ld='cc', ldflags ='-Wl,-E  -fstack-protector-strong -L/usr/local/lib'
    libpth=/usr/lib /usr/local/lib
    libs=-lpthread -lm -lutil -lc
    perllibs=-lpthread -lm -lutil -lc
    libc=/usr/lib/libc.so.90.0, so=so, useshrplib=false, libperl=libperl.a
    gnulibc_version=''
  Dynamic Linking:
    dlsrc=dl_dlopen.xs, dlext=so, d_dlsymun=undef, ccdlflags=' '
    cccdlflags='-DPIC -fPIC ', lddlflags='-shared -fPIC  -L/usr/local/lib -fstack-protector-strong'


Characteristics of this binary (from libperl): 
  Compile-time options: HAS_TIMES PERLIO_LAYERS PERL_COPY_ON_WRITE
                        PERL_DONT_CREATE_GVSV
                        PERL_HASH_FUNC_ONE_AT_A_TIME_HARD PERL_MALLOC_WRAP
                        PERL_PRESERVE_IVUV USE_64_BIT_ALL USE_64_BIT_INT
                        USE_LARGE_FILES USE_LOCALE USE_LOCALE_COLLATE
                        USE_LOCALE_CTYPE USE_LOCALE_NUMERIC USE_LOCALE_TIME
                        USE_PERLIO USE_PERL_ATOF
  Locally applied patches:
	Devel::PatchPerl 1.48
  Built under openbsd
  Compiled at Feb 15 2018 18:16:36
  %ENV:
    PERL5LIB=""
    PERL5OPT=""
    PERL5_CPANPLUS_IS_RUNNING="12876"
    PERL5_CPAN_IS_RUNNING="12876"
    PERL5_CPAN_IS_RUNNING_IN_RECURSION="87058,12876"
    PERLBREW_HOME="/home/goku/.perlbrew"
    PERLBREW_MANPATH="/home/goku/perl5/perlbrew/perls/perl-5.24.3/man"
    PERLBREW_PATH="/home/goku/perl5/perlbrew/bin:/home/goku/perl5/perlbrew/perls/perl-5.24.3/bin"
    PERLBREW_PERL="perl-5.24.3"
    PERLBREW_ROOT="/home/goku/perl5/perlbrew"
    PERLBREW_SHELLRC_VERSION="0.82"
    PERLBREW_VERSION="0.82"
    PERL_CR_SMOKER_CURRENT="Bio-Roary-3.12.0"
    PERL_EXTUTILS_AUTOINSTALL="--defaultdeps"
    PERL_MM_USE_DEFAULT="1"
  @INC:
    /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3/OpenBSD.amd64-openbsd
    /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/site_perl/5.24.3
    /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/5.24.3/OpenBSD.amd64-openbsd
    /home/goku/perl5/perlbrew/perls/perl-5.24.3/lib/5.24.3
    .