Bio-Roary v3.11.1 Perl 5 v5.24.3 i386-freebsd-thread-multi-64int
- Status
- Fail
- From
- Chris Williams (BINGOS)
- Dist
-
Bio-Roary v3.11.1
- Platform
- Perl 5 v5.24.3 i386-freebsd-thread-multi-64int
- Date
- 2018-01-15 01:34:50
- ID
- 47454e76-f994-11e7-9abe-a171f40b351c
This distribution has been tested as part of the CPAN Testers
project, supporting the Perl programming language. See
http://wiki.cpantesters.org/ for more information or email
questions to cpan-testers-discuss@perl.org
--
Dear AJPAGE,
This is a computer-generated error report created automatically by
CPANPLUS, version 0.9172. Testers personal comments may appear
at the end of this report.
Thank you for uploading your work to CPAN. However, it appears that
there were some problems testing your distribution.
TEST RESULTS:
Below is the error stack from stage 'make test':
PERL_DL_NONLAZY=1 "/usr/home/cpan/pit/rel/perl-5.24.3/bin/perl" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(0, 'blib/lib', 'blib/arch')" t/*.t t/Bio/Roary/*.t t/Bio/Roary/CommandLine/*.t t/Bio/Roary/External/*.t t/Bio/Roary/Output/*.t t/Bio/Roary/QC/*.t
#
# Versions for all modules listed in MYMETA.json (including optional ones):
#
# === Configure Requires ===
#
# Module Want Have
# ------------------- ---- ----
# ExtUtils::MakeMaker any 7.30
#
# === Build Requires ===
#
# Module Want Have
# ------------------- ---- ----
# ExtUtils::MakeMaker any 7.30
#
# === Test Requires ===
#
# Module Want Have
# ------------------- ---- --------
# Data::Dumper any 2.160
# Env::Path any 0.19
# ExtUtils::MakeMaker any 7.30
# File::Spec any 3.63_01
# Test::Files any 0.14
# Test::More any 1.302120
# Test::Most any 0.35
# Test::Output any 1.031
#
# === Test Recommends ===
#
# Module Want Have
# ---------- -------- --------
# CPAN::Meta 2.120900 2.150010
#
# === Runtime Requires ===
#
# Module Want Have
# ------------------- ---- -------
# Array::Utils any 0.5
# Bio::Perl any undef
# Bio::SeqIO any undef
# Bio::Tools::GFF any undef
# Bio::TreeIO any undef
# Cwd any 3.63_01
# Digest::MD5::File any 0.08
# Exception::Class any 1.44
# File::Basename any 2.85
# File::Copy any 2.31
# File::Find::Rule any 0.34
# File::Grep any 0.02
# File::Path any 2.15
# File::Slurper any 0.011
# File::Spec any 3.63_01
# File::Temp any 0.2304
# File::Which any 1.22
# FindBin any 1.51
# Getopt::Long any 2.48
# Graph any 0.9704
# Graph::Writer::Dot any 2.09
# List::Util any 1.49
# Log::Log4perl any 1.49
# Moose any 2.2009
# Moose::Role any 2.2009
# POSIX any 1.65_01
# PerlIO::utf8_strict any 0.007
# Text::CSV any 1.95
# strict any 1.11
# warnings any 1.36
#
t/00-report-prereqs.t ................................... ok
# Failed test 'blastp in PATH'
# at t/00_requires_external.t line 19.
# Failed test 'makeblastdb in PATH'
# at t/00_requires_external.t line 19.
# Failed test 'mcl in PATH'
# at t/00_requires_external.t line 19.
# Failed test 'mcxdeblast in PATH'
# at t/00_requires_external.t line 19.
# Failed test 'bedtools in PATH'
# at t/00_requires_external.t line 19.
# Failed test 'prank in PATH'
# at t/00_requires_external.t line 19.
# Failed test 'parallel in PATH'
# at t/00_requires_external.t line 19.
# Failed test 'mafft in PATH'
# at t/00_requires_external.t line 19.
# Looks like you failed 8 tests of 8.
t/00_requires_external.t ................................
Dubious, test returned 8 (wstat 2048, 0x800)
Failed 8/8 subtests
t/author-00-compile.t ................................... skipped: these tests are for testing by the author
t/author-pod-syntax.t ................................... skipped: these tests are for testing by the author
t/Bio/Roary/AccessoryBinaryFasta.t ...................... ok
Cant open file: _accessory_clusters.clstr# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 2 just after 2.
t/Bio/Roary/AccessoryClustering.t .......................
Dubious, test returned 2 (wstat 512, 0x200)
All 2 subtests passed
t/Bio/Roary/AnalyseGroups.t ............................. ok
t/Bio/Roary/AnnotateGroups.t ............................ ok
t/Bio/Roary/AssemblyStatistics.t ........................ ok
t/Bio/Roary/ChunkFastaFile.t ............................ ok
t/Bio/Roary/CombinedProteome.t .......................... ok
# Failed test 'Actual output file exists example_annotation.gff.proteome.faa -t 1 t/data/example_annotation.gff'
# at t/lib/TestHelper.pm line 139.
# Failed test 'Actual and expected output match for '-t 1 t/data/example_annotation.gff''
# at t/lib/TestHelper.pm line 148.
# example_annotation.gff.proteome.faa absent
# Failed test 'Actual output file exists example_annotation.gff.proteome.faa t/data/example_annotation.gff'
# at t/lib/TestHelper.pm line 139.
# Failed test 'Actual and expected output match for 't/data/example_annotation.gff''
# at t/lib/TestHelper.pm line 148.
# example_annotation.gff.proteome.faa absent
# Looks like you failed 4 tests of 7.
t/Bio/Roary/CommandLine/ExtractProteomeFromGff.t ........
Dubious, test returned 4 (wstat 1024, 0x400)
Failed 4/7 subtests
t/Bio/Roary/CommandLine/GeneAlignmentFromNucleotides.t .. ok
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/bin/dummy_makeblastdb line 2.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/bin/dummy_makeblastdb line 2.
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/bin/dummy_blastp line 2.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/bin/dummy_blastp line 2.
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/bin/dummy_makeblastdb line 2.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/bin/dummy_makeblastdb line 2.
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/bin/dummy_blastp line 2.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/bin/dummy_blastp line 2.
t/Bio/Roary/CommandLine/ParallelAllAgainstAllBlastp.t ... ok
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
grep: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/E66KeYZOPU/query_1.gff.proteome.faa: No such file or directory
grep: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/E66KeYZOPU/query_2.gff.proteome.faa: No such file or directory
grep: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/E66KeYZOPU/query_3.gff.proteome.faa: No such file or directory
grep: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/E66KeYZOPU/query_1.gff.proteome.faa: No such file or directory
grep: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/E66KeYZOPU/query_2.gff.proteome.faa: No such file or directory
grep: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/E66KeYZOPU/query_3.gff.proteome.faa: No such file or directory
grep: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/E66KeYZOPU/query_1.gff.proteome.faa: No such file or directory
grep: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/E66KeYZOPU/query_2.gff.proteome.faa: No such file or directory
grep: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/E66KeYZOPU/query_3.gff.proteome.faa: No such file or directory
grep: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/E66KeYZOPU/query_1.gff.proteome.faa: No such file or directory
grep: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/E66KeYZOPU/query_2.gff.proteome.faa: No such file or directory
grep: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/E66KeYZOPU/query_3.gff.proteome.faa: No such file or directory
# Failed test 'Actual and expected sorted output match for '-g t/data/query_groups -a difference -i t/data/query_1.gff -t t/data/query_2.gff,t/data/query_3.gff''
# at t/lib/TestHelper.pm line 38.
# Structures begin differing at:
# $got->[1] = Does not exist
# $expected->[1] = ARRAY(0x2b28649c)
# Looks like you failed 1 test of 37.
t/Bio/Roary/CommandLine/QueryRoary.t ....................
Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/37 subtests
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
# Failed test 'Actual output file exists gene_presence_absence.csv -j Local -t 1 --dont_split_groups t/data/genbank_gbff/genbank1.gff t/data/genbank_gbff/genbank2.gff t/data/genbank_gbff/genbank3.gff'
# at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/lib/TestHelper.pm line 249.
# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 2 just after 3.
t/Bio/Roary/CommandLine/Roary.t .........................
Dubious, test returned 2 (wstat 512, 0x200)
Failed 1/3 subtests
t/Bio/Roary/CommandLine/RoaryCoreAlignment.t ............ ok
t/Bio/Roary/CommandLine/RoaryPostAnalysis.t ............. ok
t/Bio/Roary/CommandLine/RoaryReorderSpreadsheet.t ....... ok
t/Bio/Roary/CommandLine/TransferAnnotationToGroups.t .... ok
t/Bio/Roary/ContigsToGeneIDsFromGFF.t ................... ok
t/Bio/Roary/EmblGroups.t ................................ ok
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/bin/dummy_blastp line 2.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/bin/dummy_blastp line 2.
t/Bio/Roary/External/Blastp.t ........................... ok
t/Bio/Roary/External/Cdhit.t ............................ ok
# Failed test 'Check for parallel'
# at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/01/15 01:33:58 ERROR: Can't find required 'parallel' in your $PATH
#
# doesn't match:
# (?^:Looking for 'parallel' - found )
# as expected
# Failed test 'Check for blastp'
# at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/01/15 01:33:58 ERROR: Can't find required 'blastp' in your $PATH
#
# doesn't match:
# (?^:Looking for 'blastp' - found )
# as expected
# Failed test 'Check for makeblastdb'
# at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/01/15 01:33:58 ERROR: Can't find required 'makeblastdb' in your $PATH
#
# doesn't match:
# (?^:Looking for 'makeblastdb' - found )
# as expected
# Failed test 'Check for mcl'
# at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/01/15 01:33:58 ERROR: Can't find required 'mcl' in your $PATH
#
# doesn't match:
# (?^:Looking for 'mcl' - found )
# as expected
# Failed test 'Check for bedtools'
# at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/01/15 01:33:58 ERROR: Can't find required 'bedtools' in your $PATH
#
# doesn't match:
# (?^:Looking for 'bedtools' - found )
# as expected
# Failed test 'Check for prank'
# at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/01/15 01:33:58 Optional tool 'prank' not found in your $PATH
#
# doesn't match:
# (?^:Looking for 'prank' - found )
# as expected
# Failed test 'Check for mafft'
# at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2018/01/15 01:33:58 ERROR: Can't find required 'mafft' in your $PATH
#
# doesn't match:
# (?^:Looking for 'mafft' - found )
# as expected
# Looks like you failed 7 tests of 13.
t/Bio/Roary/External/CheckTools.t .......................
Dubious, test returned 7 (wstat 1792, 0x700)
Failed 7/13 subtests
mafft: not found
# Failed test 'output for mafft matches'
# at t/Bio/Roary/External/Mafft.t line 39.
# +---+-----+---+-----------------------------------------------------------------------------+
# | |Got | |Expected |
# | Ln| | Ln| |
# +---+-----+---+-----------------------------------------------------------------------------+
# | | * 1|>1111#5_04506 *
# | | * 2|------------------------------------------------------------ *
# | | * 3|------------------------------------------------------------ *
# | | * 4|------------------------------------------------------------ *
# | | * 5|------------------------------------------------------------ *
# | | * 6|------------------------------------------------------------ *
# | | * 7|------------------------------------------------------------ *
# | | * 8|------------------------------------------------------------ *
# | | * 9|---------atggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg *
# | | * 10|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct *
# | | * 11|attgataataaagttcaaccgcttatcaggcgttga *
# | | * 12|>1234_8#75_04759 *
# | | * 13|atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa *
# | | * 14|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat *
# | | * 15|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg *
# | | * 16|ctggattctttccggcgggatagtgctttttatacctggttgtatcgtattgcggtcaat *
# | | * 17|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg *
# | | * 18|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac *
# | | * 19|ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa *
# | | * 20|gatttacgtatggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg *
# | | * 21|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct *
# | | * 22|attgataataaagttcaaccgcttatcaggcgttga *
# | | * 23|>Salmonella_enterica_subsp_enterica_serovar_Typhimurium_DT104_v1_02853 *
# | | * 24|atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa *
# | | * 25|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat *
# | | * 26|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg *
# | | * 27|ctggattctttccggggggatagtgctttttatacctggttgtatcgtattgcggtcaat *
# | | * 28|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg *
# | | * 29|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac *
# | | * 30|ttaatgttttcagaagaactgagacagatagttttccgaactattgagtccctcccggaa *
# | | * 31|gatttacgtatggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg *
# | | * 32|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct *
# | | * 33|attgataataaagttcaaccgcttatcaggcgttga *
# | | * 34|>Salmonella_enterica_subsp_enterica_serovar_Typhimurium_SL1344_v2_02736 *
# | | * 35|atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa *
# | | * 36|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat *
# | | * 37|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg *
# | | * 38|ctggattctttccggggggatagtgctttttatacctggttgtatcgtattgcggtcaat *
# | | * 39|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg *
# | | * 40|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac *
# | | * 41|ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa *
# | | * 42|gatttacgtatggcaatcaccttacgggagctggatggcctgagctgtgaagagatagcg *
# | | * 43|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct *
# | | * 44|attgataataaagttcaaccgcttatcaggcgttga *
# | | * 45|>Salmonella_enterica_subsp_enterica_serovar_Typhimurium_str_D23580_v1_02783 *
# | | * 46|atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa *
# | | * 47|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat *
# | | * 48|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg *
# | | * 49|ctggattctttccggggggatagtgctttttatacctggttgtatcgtattgcggtcaat *
# | | * 50|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg *
# | | * 51|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac *
# | | * 52|ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa *
# | | * 53|gatttacgtatggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg *
# | | * 54|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct *
# | | * 55|attgataataaagttcaaccgcttatcaggcgttga *
# | | * 56|>Salmonella_enterica_subsp_enterica_serovar_Typhimurium_str_DT2_v1_02741 *
# | | * 57|atgagcgagcagttaacggac---gtcctggttgaacgggtccagaagggagatcagaaa *
# | | * 58|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat *
# | | * 59|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg *
# | | * 60|ctggattctttccggggggatagtgctttttatacctggttgtatcgtattgcggtcaat *
# | | * 61|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg *
# | | * 62|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac *
# | | * 63|ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa *
# | | * 64|gatttacgtatggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg *
# | | * 65|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct *
# | | * 66|attgataataaagttcaaccgcttatcaggcgttga *
# +---+-----+---+-----------------------------------------------------------------------------+
# Looks like you failed 1 test of 6.
t/Bio/Roary/External/Mafft.t ............................
Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/6 subtests
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/bin/dummy_makeblastdb line 2.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/bin/dummy_makeblastdb line 2.
t/Bio/Roary/External/Makeblastdb.t ...................... ok
2018/01/15 01:34:03 Cannot find the mcxdeblast executable, please ensure its in your PATH
# Tests were run but no plan was declared and done_testing() was not seen.
t/Bio/Roary/External/Mcl.t ..............................
Dubious, test returned 254 (wstat 65024, 0xfe00)
All 5 subtests passed
# Failed test 'output file exists'
# at t/Bio/Roary/External/Prank.t line 33.
------------- EXCEPTION -------------
MSG: Could not read file 't/data/prank_input.fa.aln': No such file or directory
STACK Bio::Root::IO::_initialize_io /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NmhSVoT5RE/BioPerl-1.007002/blib/lib/Bio/Root/IO.pm:268
STACK Bio::SeqIO::_initialize /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NmhSVoT5RE/BioPerl-1.007002/blib/lib/Bio/SeqIO.pm:513
STACK Bio::SeqIO::fasta::_initialize /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NmhSVoT5RE/BioPerl-1.007002/blib/lib/Bio/SeqIO/fasta.pm:87
STACK Bio::SeqIO::new /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NmhSVoT5RE/BioPerl-1.007002/blib/lib/Bio/SeqIO.pm:389
STACK Bio::SeqIO::new /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NmhSVoT5RE/BioPerl-1.007002/blib/lib/Bio/SeqIO.pm:435
STACK Bio::Roary::SortFasta::_build__input_seqio /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/lib/Bio/Roary/SortFasta.pm:27
STACK Bio::Roary::SortFasta::_input_seqio reader Bio::Roary::SortFasta::_input_seqio (defined at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/lib/Bio/Roary/SortFasta.pm line 17):8
STACK Bio::Roary::SortFasta::sort_fasta /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/lib/Bio/Roary/SortFasta.pm:68
STACK toplevel t/Bio/Roary/External/Prank.t:38
-------------------------------------
# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 2 just after 5.
t/Bio/Roary/External/Prank.t ............................
Dubious, test returned 2 (wstat 512, 0x200)
Failed 1/5 subtests
t/Bio/Roary/ExtractCoreGenesFromSpreadsheet.t ........... ok
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
# Failed test 'content of proteome 1 as expected'
# at t/Bio/Roary/ExtractProteomeFromGFFs.t line 30.
# /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/ttDnimKw7o/example_annotation.gff.proteome.faa absent
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
# Failed test 'content of proteome 1 as expected'
# at t/Bio/Roary/ExtractProteomeFromGFFs.t line 44.
# /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/WNxnzdoSU6/example_annotation_2.gff.proteome.faa absent
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
# Failed test 'content of proteome /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/P9ORjTBghK/genbank1.gff.proteome.faa as expected'
# at t/Bio/Roary/ExtractProteomeFromGFFs.t line 64.
# /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/P9ORjTBghK/genbank1.gff.proteome.faa absent
# Failed test 'content of proteome /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/P9ORjTBghK/genbank2.gff.proteome.faa as expected'
# at t/Bio/Roary/ExtractProteomeFromGFFs.t line 64.
# /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/P9ORjTBghK/genbank2.gff.proteome.faa absent
# Failed test 'content of proteome /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/P9ORjTBghK/genbank3.gff.proteome.faa as expected'
# at t/Bio/Roary/ExtractProteomeFromGFFs.t line 64.
# /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/P9ORjTBghK/genbank3.gff.proteome.faa absent
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
# Failed test 'content of proteome /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/_otxb6pRch/query_1.gff.proteome.faa as expected'
# at t/Bio/Roary/ExtractProteomeFromGFFs.t line 87.
# /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/_otxb6pRch/query_1.gff.proteome.faa absent
# Failed test 'content of proteome /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/_otxb6pRch/query_2.gff.proteome.faa as expected'
# at t/Bio/Roary/ExtractProteomeFromGFFs.t line 87.
# /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/_otxb6pRch/query_2.gff.proteome.faa absent
# Failed test 'content of proteome /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/_otxb6pRch/query_3.gff.proteome.faa as expected'
# at t/Bio/Roary/ExtractProteomeFromGFFs.t line 87.
# /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/_otxb6pRch/query_3.gff.proteome.faa absent
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
# Failed test 'content of proteome /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/SPxY2X_nIW/annotation_1.gff.proteome.faa as expected'
# at t/Bio/Roary/ExtractProteomeFromGFFs.t line 112.
# /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/SPxY2X_nIW/annotation_1.gff.proteome.faa absent
# Failed test 'content of proteome /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/SPxY2X_nIW/annotation_2.gff.proteome.faa as expected'
# at t/Bio/Roary/ExtractProteomeFromGFFs.t line 112.
# /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/SPxY2X_nIW/annotation_2.gff.proteome.faa absent
# Looks like you failed 10 tests of 20.
t/Bio/Roary/ExtractProteomeFromGFFs.t ...................
Dubious, test returned 10 (wstat 2560, 0xa00)
Failed 10/20 subtests
t/Bio/Roary/FilterFullClusters.t ........................ ok
t/Bio/Roary/GeneNamesFromGFF.t .......................... ok
t/Bio/Roary/GroupLabels.t ............................... ok
t/Bio/Roary/GroupStatistics.t ........................... ok
t/Bio/Roary/InflateClusters.t ........................... ok
t/Bio/Roary/OrderGenes.t ................................ ok
t/Bio/Roary/Output/CoreGeneAlignmentCoorindatesEMBL.t ... ok
t/Bio/Roary/Output/DifferenceBetweenSets.t .............. ok
t/Bio/Roary/Output/GroupsMultifastaProtein.t ............ ok
t/Bio/Roary/Output/GroupsMultifastas.t .................. ok
Attribute (fasta_file) does not pass the type constraint because: Validation failed for 'Str' with value undef at reader Bio::Roary::Output::GroupsMultifastaNucleotide::fasta_file (defined at lib/Bio/Roary/Output/GroupsMultifastaNucleotide.pm line 29) line 15
Bio::Roary::Output::GroupsMultifastaNucleotide::fasta_file('Bio::Roary::Output::GroupsMultifastaNucleotide=HASH(0x2a394ce4)') called at lib/Bio/Roary/Output/GroupsMultifastaNucleotide.pm line 43
Bio::Roary::Output::GroupsMultifastaNucleotide::_build__input_seqio('Bio::Roary::Output::GroupsMultifastaNucleotide=HASH(0x2a394ce4)') called at reader Bio::Roary::Output::GroupsMultifastaNucleotide::_input_seqio (defined at lib/Bio/Roary/Output/GroupsMultifastaNucleotide.pm line 30) line 8
Bio::Roary::Output::GroupsMultifastaNucleotide::_input_seqio('Bio::Roary::Output::GroupsMultifastaNucleotide=HASH(0x2a394ce4)') called at lib/Bio/Roary/Output/GroupsMultifastaNucleotide.pm line 53
Bio::Roary::Output::GroupsMultifastaNucleotide::populate_files('Bio::Roary::Output::GroupsMultifastaNucleotide=HASH(0x2a394ce4)') called at lib/Bio/Roary/Output/GroupsMultifastasNucleotide.pm line 65
Bio::Roary::Output::GroupsMultifastasNucleotide::create_files('Bio::Roary::Output::GroupsMultifastasNucleotide=HASH(0x2a1f7cbc)') called at t/Bio/Roary/Output/GroupsMultifastasNucleotide.t line 40
# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 127 just after 3.
t/Bio/Roary/Output/GroupsMultifastasNucleotide.t ........
Dubious, test returned 127 (wstat 32512, 0x7f00)
All 3 subtests passed
t/Bio/Roary/Output/NumberOfGroups.t ..................... ok
t/Bio/Roary/Output/QueryGroups.t ........................ ok
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/bin/dummy_makeblastdb line 2.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/bin/dummy_makeblastdb line 2.
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/bin/dummy_blastp line 2.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/t/bin/dummy_blastp line 2.
t/Bio/Roary/ParallelAllAgainstAllBlast.t ................ ok
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
Can't load '/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so' for module List::Util: /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch/auto/List/Util/Util.so: Undefined symbol "Perl_newSVpvf_nocontext" at /opt/perl-5.26.1/lib/5.26.1/i386-freebsd-64int/DynaLoader.pm line 193.
at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib/Scalar/Util.pm line 23.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib/Moose.pm line 9.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/lib/Bio/Roary/CommandLine/ExtractProteomeFromGff.pm line 7.
Compilation failed in require at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
BEGIN failed--compilation aborted at /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script/extract_proteome_from_gff line 12.
t/Bio/Roary/PrepareInputFiles.t ......................... ok
t/Bio/Roary/PresenceAbsenceMatrix.t ..................... ok
t/Bio/Roary/QC/Report.t ................................. ok
2018/01/15 01:34:39 Input file contains duplicate gene IDs, attempting to fix by adding a unique suffix, new GFF in the fixed_input_files directory: t/data/reformat_input_gffs/query_2.gff
2018/01/15 01:34:39 Input file contains duplicate gene IDs, attempting to fix by adding a unique suffix, new GFF in the fixed_input_files directory: t/data/reformat_input_gffs/query_2.gff
t/Bio/Roary/ReformatInputGFFs.t ......................... ok
t/Bio/Roary/ReorderSpreadsheet.t ........................ ok
t/Bio/Roary/SampleOrder.t ............................... ok
t/Bio/Roary/SequenceLengths.t ........................... ok
t/Bio/Roary/SortFasta.t ................................. ok
t/Bio/Roary/SplitGroups.t ............................... ok
t/Bio/Roary/UniqueGenesPerSample.t ...................... ok
Test Summary Report
-------------------
t/00_requires_external.t (Wstat: 2048 Tests: 8 Failed: 8)
Failed tests: 1-8
Non-zero exit status: 8
t/Bio/Roary/AccessoryClustering.t (Wstat: 512 Tests: 2 Failed: 0)
Non-zero exit status: 2
Parse errors: No plan found in TAP output
t/Bio/Roary/CommandLine/ExtractProteomeFromGff.t (Wstat: 1024 Tests: 7 Failed: 4)
Failed tests: 4-7
Non-zero exit status: 4
t/Bio/Roary/CommandLine/QueryRoary.t (Wstat: 256 Tests: 37 Failed: 1)
Failed test: 27
Non-zero exit status: 1
t/Bio/Roary/CommandLine/Roary.t (Wstat: 512 Tests: 3 Failed: 1)
Failed test: 3
Non-zero exit status: 2
Parse errors: No plan found in TAP output
t/Bio/Roary/External/CheckTools.t (Wstat: 1792 Tests: 13 Failed: 7)
Failed tests: 3-9
Non-zero exit status: 7
t/Bio/Roary/External/Mafft.t (Wstat: 256 Tests: 6 Failed: 1)
Failed test: 6
Non-zero exit status: 1
t/Bio/Roary/External/Mcl.t (Wstat: 65024 Tests: 5 Failed: 0)
Non-zero exit status: 254
Parse errors: No plan found in TAP output
t/Bio/Roary/External/Prank.t (Wstat: 512 Tests: 5 Failed: 1)
Failed test: 5
Non-zero exit status: 2
Parse errors: No plan found in TAP output
t/Bio/Roary/ExtractProteomeFromGFFs.t (Wstat: 2560 Tests: 20 Failed: 10)
Failed tests: 4, 6, 9-11, 14-16, 19-20
Non-zero exit status: 10
t/Bio/Roary/Output/GroupsMultifastasNucleotide.t (Wstat: 32512 Tests: 3 Failed: 0)
Non-zero exit status: 127
Parse errors: No plan found in TAP output
Files=55, Tests=676, 97 wallclock secs ( 0.39 usr 0.18 sys + 36.25 cusr 54.46 csys = 91.28 CPU)
Result: FAIL
Failed 11/55 test programs. 33/676 subtests failed.
*** Error code 255
Stop.
make: stopped in /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1
PREREQUISITES:
Here is a list of prerequisites you specified and versions we
managed to load:
Module Name Have Want
Array::Utils 0.5 0
Bio::Perl 0 0
Bio::SeqIO 0 0
Bio::Tools::GFF 0 0
Bio::TreeIO 0 0
Cwd 3.63_01 0
Data::Dumper 2.160 0
Digest::MD5::File 0.08 0
Env::Path 0.19 0
Exception::Class 1.44 0
ExtUtils::MakeMaker 7.30 0
File::Basename 2.85 0
File::Copy 2.31 0
File::Find::Rule 0.34 0
File::Grep 0.02 0
File::Path 2.15 0
File::Slurper 0.011 0
File::Spec 3.63_01 0
File::Temp 0.2304 0
File::Which 1.22 0
FindBin 1.51 0
Getopt::Long 2.48 0
Graph 0.9704 0
Graph::Writer::Dot 2.09 0
List::Util 1.49 0
Log::Log4perl 1.49 0
Moose 2.2009 0
Moose::Role 2.2009 0
POSIX 1.65_01 0
PerlIO::utf8_strict 0.007 0
Test::Files 0.14 0
Test::More 1.302120 0
Test::Most 0.35 0
Test::Output 1.031 0
Text::CSV 1.95 0
strict 1.11 0
warnings 1.36 0
Perl module toolchain versions installed:
Module Name Have
CPANPLUS 0.9172
CPANPLUS::Dist::Build 0.88
Cwd 3.63_01
ExtUtils::CBuilder 0.280230
ExtUtils::Command 7.30
ExtUtils::Install 2.14
ExtUtils::MakeMaker 7.30
ExtUtils::Manifest 1.70
ExtUtils::ParseXS 3.35
File::Spec 3.63_01
Module::Build 0.4224
Pod::Parser 1.63
Pod::Simple 3.32
Test2 1.302120
Test::Harness 3.39
Test::More 1.302120
version 0.9918
******************************** NOTE ********************************
The comments above are created mechanically, possibly without manual
checking by the sender. As there are many people performing automatic
tests on each upload to CPAN, it is likely that you will receive
identical messages about the same problem.
If you believe that the message is mistaken, please reply to the first
one with correction and/or additional informations, and do not take
it personally. We appreciate your patience. :)
**********************************************************************
Additional comments:
This report was machine-generated by CPANPLUS::Dist::YACSmoke 1.02.
Powered by minismokebox version 0.68
------------------------------
ENVIRONMENT AND OTHER CONTEXT
------------------------------
Environment variables:
AUTOMATED_TESTING = 1
NONINTERACTIVE_TESTING = 1
PATH = /usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/script:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/script:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qOMMN1Fg0h/Package-Stash-0.37/blib/script:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Emial2qGlE/Log-Log4perl-1.49/blib/script:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/R2sztLXby2/Parse-Yapp-1.21/blib/script:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Hw5NqG2E2Z/File-Find-Rule-0.34/blib/script:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/5mlEn6eoRE/Env-Path-0.19/blib/script:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/pdZfYhSW_L/libwww-perl-6.31/blib/script:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NmhSVoT5RE/BioPerl-1.007002/blib/script:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/cgq974pxNY/Data-Stag-0.14/blib/script:/sbin:/bin:/usr/sbin:/usr/bin:/usr/games:/usr/local/sbin:/usr/local/bin:/home/cpan/bin
PERL5LIB = :/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wKjoNZlYD8/Array-Utils-0.5/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wKjoNZlYD8/Array-Utils-0.5/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/csPDMZBEge/IO-String-1.08/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/csPDMZBEge/IO-String-1.08/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/cgq974pxNY/Data-Stag-0.14/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/cgq974pxNY/Data-Stag-0.14/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/JIitCyx3QN/Class-Data-Inheritable-0.08/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/JIitCyx3QN/Class-Data-Inheritable-0.08/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NUnag6eyaY/Devel-StackTrace-2.03/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NUnag6eyaY/Devel-StackTrace-2.03/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/VFbW50SJgd/Exception-Class-1.44/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/VFbW50SJgd/Exception-Class-1.44/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7aR3xe5mwu/Test-Deep-1.127/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7aR3xe5mwu/Test-Deep-1.127/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/LaLhyxURN_/Capture-Tiny-0.46/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/LaLhyxURN_/Capture-Tiny-0.46/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Cc5kY9II6V/Algorithm-Diff-1.1903/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Cc5kY9II6V/Algorithm-Diff-1.1903/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Wl6K1pH0Gr/Text-Diff-1.45/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Wl6K1pH0Gr/Text-Diff-1.45/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/k4rCoWCsFK/Test-Differences-0.64/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/k4rCoWCsFK/Test-Differences-0.64/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/_1d0y3HqjO/Sub-Uplevel-0.2800/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/_1d0y3HqjO/Sub-Uplevel-0.2800/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/VsWSCckR3W/Test-Exception-0.43/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/VsWSCckR3W/Test-Exception-0.43/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8DKwkZbaX7/Test-Warn-0.32/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8DKwkZbaX7/Test-Warn-0.32/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/GpVL33ROhK/Test-Most-0.35/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/GpVL33ROhK/Test-Most-0.35/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/f3oe0CkdOq/Test-Needs-0.002005/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/f3oe0CkdOq/Test-Needs-0.002005/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/lLVgVUY0D4/URI-1.73/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/lLVgVUY0D4/URI-1.73/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NmhSVoT5RE/BioPerl-1.007002/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NmhSVoT5RE/BioPerl-1.007002/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/ODwTAr3ajL/Encode-Locale-1.05/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/ODwTAr3ajL/Encode-Locale-1.05/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8wg4_LR2nR/HTTP-Date-6.02/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8wg4_LR2nR/HTTP-Date-6.02/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NtuIn4aJa8/File-Listing-6.04/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NtuIn4aJa8/File-Listing-6.04/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/ToyI8Qbz5D/HTML-Tagset-3.20/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/ToyI8Qbz5D/HTML-Tagset-3.20/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/EanaavVHRk/HTML-Parser-3.72/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/EanaavVHRk/HTML-Parser-3.72/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/0_U7StK_zP/IO-HTML-1.001/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/0_U7StK_zP/IO-HTML-1.001/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/zAMsfEN7FT/LWP-MediaTypes-6.02/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/zAMsfEN7FT/LWP-MediaTypes-6.02/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/gAeNoFaZH2/Try-Tiny-0.30/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/gAeNoFaZH2/Try-Tiny-0.30/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TwGV1cXF2W/HTTP-Message-6.14/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TwGV1cXF2W/HTTP-Message-6.14/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7O5JsUjph0/HTTP-Cookies-6.04/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7O5JsUjph0/HTTP-Cookies-6.04/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Uld1yEEV0E/HTTP-Daemon-6.01/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Uld1yEEV0E/HTTP-Daemon-6.01/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/U2jATQhoVq/HTTP-Negotiate-6.01/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/U2jATQhoVq/HTTP-Negotiate-6.01/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/UhbxO70_18/Net-HTTP-6.17/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/UhbxO70_18/Net-HTTP-6.17/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/LTqqzI7RUJ/Test-Fatal-0.014/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/LTqqzI7RUJ/Test-Fatal-0.014/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Ap9SgpYylM/Test-RequiresInternet-0.05/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Ap9SgpYylM/Test-RequiresInternet-0.05/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/sjiLFNd7Kl/WWW-RobotRules-6.02/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/sjiLFNd7Kl/WWW-RobotRules-6.02/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/pdZfYhSW_L/libwww-perl-6.31/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/pdZfYhSW_L/libwww-perl-6.31/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/HnoSStQtTD/Digest-MD5-File-0.08/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/HnoSStQtTD/Digest-MD5-File-0.08/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/5mlEn6eoRE/Env-Path-0.19/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/5mlEn6eoRE/Env-Path-0.19/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/IVBiH4c2PG/Number-Compare-0.03/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/IVBiH4c2PG/Number-Compare-0.03/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/V0RH9L_GIC/Text-Glob-0.11/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/V0RH9L_GIC/Text-Glob-0.11/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Hw5NqG2E2Z/File-Find-Rule-0.34/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Hw5NqG2E2Z/File-Find-Rule-0.34/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/P5tOJimkb_/File-Grep-0.02/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/P5tOJimkb_/File-Grep-0.02/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/BWhrlFnxfc/Test-Warnings-0.026/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/BWhrlFnxfc/Test-Warnings-0.026/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/XHdinlsBj9/File-Slurper-0.011/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/XHdinlsBj9/File-Slurper-0.011/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/g4XmKruF9O/File-Which-1.22/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/g4XmKruF9O/File-Which-1.22/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wGk9zwtdif/Graph-0.9704/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wGk9zwtdif/Graph-0.9704/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/R2sztLXby2/Parse-Yapp-1.21/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/R2sztLXby2/Parse-Yapp-1.21/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/p5u70DUkHc/XML-Parser-2.44/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/p5u70DUkHc/XML-Parser-2.44/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7Sk3rz5o2w/XML-Writer-0.625/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7Sk3rz5o2w/XML-Writer-0.625/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/nQ9triWMeO/Graph-ReadWrite-2.09/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/nQ9triWMeO/Graph-ReadWrite-2.09/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Emial2qGlE/Log-Log4perl-1.49/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Emial2qGlE/Log-Log4perl-1.49/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eQrpvmfDof/Module-Runtime-0.016/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eQrpvmfDof/Module-Runtime-0.016/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/upeu8WvUzZ/Dist-CheckConflicts-0.11/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/upeu8WvUzZ/Dist-CheckConflicts-0.11/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DsGmyIr1KO/CPAN-Meta-Check-0.014/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DsGmyIr1KO/CPAN-Meta-Check-0.014/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/zgtybozy0M/Params-Util-1.07/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/zgtybozy0M/Params-Util-1.07/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/EI8dMOO9Yy/Sub-Install-0.928/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/EI8dMOO9Yy/Sub-Install-0.928/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DkkjUuNHSn/Data-OptList-0.110/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DkkjUuNHSn/Data-OptList-0.110/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/51qs8YlCmg/Test-Requires-0.10/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/51qs8YlCmg/Test-Requires-0.10/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/uTYblVDahh/Module-Implementation-0.09/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/uTYblVDahh/Module-Implementation-0.09/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/byIa9ADinJ/Package-Stash-XS-0.28/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/byIa9ADinJ/Package-Stash-XS-0.28/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qOMMN1Fg0h/Package-Stash-0.37/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qOMMN1Fg0h/Package-Stash-0.37/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DeDfzugltP/Class-Load-0.24/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DeDfzugltP/Class-Load-0.24/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eLDssxjXI0/Class-Load-XS-0.10/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eLDssxjXI0/Class-Load-XS-0.10/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/OEpSHE5dvf/Sub-Exporter-Progressive-0.001013/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/OEpSHE5dvf/Sub-Exporter-Progressive-0.001013/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8F_G_OfefG/Devel-GlobalDestruction-0.14/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8F_G_OfefG/Devel-GlobalDestruction-0.14/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qq0Hqxl1Oc/MRO-Compat-0.13/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qq0Hqxl1Oc/MRO-Compat-0.13/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qvvEh8g69A/Sub-Identify-0.14/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qvvEh8g69A/Sub-Identify-0.14/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/U4mG1K6eLS/Devel-OverloadInfo-0.004/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/U4mG1K6eLS/Devel-OverloadInfo-0.004/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/aYTlsE1egK/Eval-Closure-0.14/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/aYTlsE1egK/Eval-Closure-0.14/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Itqsg5iSNc/Module-Runtime-Conflicts-0.003/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Itqsg5iSNc/Module-Runtime-Conflicts-0.003/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/XXnmiwbh7L/Sub-Name-0.21/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/XXnmiwbh7L/Sub-Name-0.21/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AHJTxkARto/Package-DeprecationManager-0.17/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AHJTxkARto/Package-DeprecationManager-0.17/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eTHMmlT9es/Sub-Exporter-0.987/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eTHMmlT9es/Sub-Exporter-0.987/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/4yRCiYyHAc/File-pushd-1.014/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/4yRCiYyHAc/File-pushd-1.014/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wvyDyElHkt/Devel-Hide-0.0009/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wvyDyElHkt/Devel-Hide-0.0009/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/boT5KfT3C_/Variable-Magic-0.62/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/boT5KfT3C_/Variable-Magic-0.62/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/OytRewswC6/B-Hooks-EndOfScope-0.21/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/OytRewswC6/B-Hooks-EndOfScope-0.21/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TAf3PA8zqK/namespace-clean-0.27/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TAf3PA8zqK/namespace-clean-0.27/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TagwvmY7wD/Test-CleanNamespaces-0.22/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TagwvmY7wD/Test-CleanNamespaces-0.22/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/5adRf56_PT/PerlIO-utf8_strict-0.007/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/5adRf56_PT/PerlIO-utf8_strict-0.007/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Hn28OiO2us/Test-Files-0.14/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Hn28OiO2us/Test-Files-0.14/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/q9r4V1JR39/Test-Output-1.031/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/q9r4V1JR39/Test-Output-1.031/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/t8AUKV3hI4/Text-CSV-1.95/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/t8AUKV3hI4/Text-CSV-1.95/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/arch
PERL5_CPANPLUS_IS_RUNNING = 93569
PERL5_CPANPLUS_IS_VERSION = 0.9172
PERL5_MINISMOKEBOX = 0.68
PERL5_YACSMOKE_BASE = /usr/home/cpan/pit/rel/conf/perl-5.24.3
PERL_EXTUTILS_AUTOINSTALL = --defaultdeps
PERL_MM_USE_DEFAULT = 1
SHELL = /usr/local/bin/bash
TERM = screen
Perl special variables (and OS-specific diagnostics, for MSWin32):
Perl: $^X = /usr/home/cpan/pit/rel/perl-5.24.3/bin/perl
UID: $< = 1002
EUID: $> = 1002
GID: $( = 1002 1002
EGID: $) = 1002 1002
-------------------------------
--
Summary of my perl5 (revision 5 version 24 subversion 3) configuration:
Platform:
osname=freebsd, osvers=10.3-release-p24, archname=i386-freebsd-thread-multi-64int
uname='freebsd froggle 10.3-release-p24 freebsd 10.3-release-p24 #0: wed nov 15 04:55:07 utc 2017 root@amd64-builder.daemonology.net:usrobjusrsrcsysgeneric i386 '
config_args='-des -Dprefix=/usr/home/cpan/pit/rel/perl-5.24.3 -Dusethreads -Duse64bitint'
hint=recommended, useposix=true, d_sigaction=define
useithreads=define, usemultiplicity=define
use64bitint=define, use64bitall=undef, uselongdouble=undef
usemymalloc=n, bincompat5005=undef
Compiler:
cc='cc', ccflags ='-DHAS_FPSETMASK -DHAS_FLOATINGPOINT_H -fno-strict-aliasing -pipe -fstack-protector -I/usr/local/include -D_FORTIFY_SOURCE=2',
optimize='-O',
cppflags='-DHAS_FPSETMASK -DHAS_FLOATINGPOINT_H -fno-strict-aliasing -pipe -fstack-protector -I/usr/local/include'
ccversion='', gccversion='4.2.1 Compatible FreeBSD Clang 3.4.1 (tags/RELEASE_34/dot1-final 208032)', gccosandvers=''
intsize=4, longsize=4, ptrsize=4, doublesize=8, byteorder=12345678, doublekind=3
d_longlong=define, longlongsize=8, d_longdbl=define, longdblsize=12, longdblkind=3
ivtype='long long', ivsize=8, nvtype='double', nvsize=8, Off_t='off_t', lseeksize=8
alignbytes=4, prototype=define
Linker and Libraries:
ld='cc', ldflags ='-pthread -Wl,-E -fstack-protector -L/usr/local/lib'
libpth=/usr/lib /usr/local/lib /usr/include/clang/3.4.1 /usr/lib
libs=-lpthread -lgdbm -lm -lcrypt -lutil -lelf
perllibs=-lpthread -lm -lcrypt -lutil -lelf
libc=, so=so, useshrplib=false, libperl=libperl.a
gnulibc_version=''
Dynamic Linking:
dlsrc=dl_dlopen.xs, dlext=so, d_dlsymun=undef, ccdlflags=' '
cccdlflags='-DPIC -fPIC', lddlflags='-shared -L/usr/local/lib -fstack-protector'
Characteristics of this binary (from libperl):
Compile-time options: HAS_TIMES MULTIPLICITY PERLIO_LAYERS
PERL_COPY_ON_WRITE PERL_DONT_CREATE_GVSV
PERL_HASH_FUNC_ONE_AT_A_TIME_HARD
PERL_IMPLICIT_CONTEXT PERL_MALLOC_WRAP
PERL_PRESERVE_IVUV USE_64_BIT_INT USE_ITHREADS
USE_LARGE_FILES USE_LOCALE USE_LOCALE_COLLATE
USE_LOCALE_CTYPE USE_LOCALE_NUMERIC USE_LOCALE_TIME
USE_PERLIO USE_PERL_ATOF USE_REENTRANT_API
Locally applied patches:
Devel::PatchPerl 1.48
Built under freebsd
Compiled at Dec 22 2017 11:21:55
%ENV:
PERL5LIB=":/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wKjoNZlYD8/Array-Utils-0.5/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wKjoNZlYD8/Array-Utils-0.5/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/csPDMZBEge/IO-String-1.08/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/csPDMZBEge/IO-String-1.08/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/cgq974pxNY/Data-Stag-0.14/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/cgq974pxNY/Data-Stag-0.14/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/JIitCyx3QN/Class-Data-Inheritable-0.08/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/JIitCyx3QN/Class-Data-Inheritable-0.08/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NUnag6eyaY/Devel-StackTrace-2.03/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NUnag6eyaY/Devel-StackTrace-2.03/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/VFbW50SJgd/Exception-Class-1.44/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/VFbW50SJgd/Exception-Class-1.44/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7aR3xe5mwu/Test-Deep-1.127/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7aR3xe5mwu/Test-Deep-1.127/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/LaLhyxURN_/Capture-Tiny-0.46/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/LaLhyxURN_/Capture-Tiny-0.46/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Cc5kY9II6V/Algorithm-Diff-1.1903/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Cc5kY9II6V/Algorithm-Diff-1.1903/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Wl6K1pH0Gr/Text-Diff-1.45/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Wl6K1pH0Gr/Text-Diff-1.45/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/k4rCoWCsFK/Test-Differences-0.64/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/k4rCoWCsFK/Test-Differences-0.64/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/_1d0y3HqjO/Sub-Uplevel-0.2800/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/_1d0y3HqjO/Sub-Uplevel-0.2800/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/VsWSCckR3W/Test-Exception-0.43/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/VsWSCckR3W/Test-Exception-0.43/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8DKwkZbaX7/Test-Warn-0.32/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8DKwkZbaX7/Test-Warn-0.32/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/GpVL33ROhK/Test-Most-0.35/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/GpVL33ROhK/Test-Most-0.35/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/f3oe0CkdOq/Test-Needs-0.002005/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/f3oe0CkdOq/Test-Needs-0.002005/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/lLVgVUY0D4/URI-1.73/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/lLVgVUY0D4/URI-1.73/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NmhSVoT5RE/BioPerl-1.007002/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NmhSVoT5RE/BioPerl-1.007002/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/ODwTAr3ajL/Encode-Locale-1.05/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/ODwTAr3ajL/Encode-Locale-1.05/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8wg4_LR2nR/HTTP-Date-6.02/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8wg4_LR2nR/HTTP-Date-6.02/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NtuIn4aJa8/File-Listing-6.04/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NtuIn4aJa8/File-Listing-6.04/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/ToyI8Qbz5D/HTML-Tagset-3.20/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/ToyI8Qbz5D/HTML-Tagset-3.20/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/EanaavVHRk/HTML-Parser-3.72/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/EanaavVHRk/HTML-Parser-3.72/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/0_U7StK_zP/IO-HTML-1.001/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/0_U7StK_zP/IO-HTML-1.001/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/zAMsfEN7FT/LWP-MediaTypes-6.02/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/zAMsfEN7FT/LWP-MediaTypes-6.02/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/gAeNoFaZH2/Try-Tiny-0.30/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/gAeNoFaZH2/Try-Tiny-0.30/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TwGV1cXF2W/HTTP-Message-6.14/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TwGV1cXF2W/HTTP-Message-6.14/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7O5JsUjph0/HTTP-Cookies-6.04/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7O5JsUjph0/HTTP-Cookies-6.04/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Uld1yEEV0E/HTTP-Daemon-6.01/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Uld1yEEV0E/HTTP-Daemon-6.01/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/U2jATQhoVq/HTTP-Negotiate-6.01/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/U2jATQhoVq/HTTP-Negotiate-6.01/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/UhbxO70_18/Net-HTTP-6.17/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/UhbxO70_18/Net-HTTP-6.17/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/LTqqzI7RUJ/Test-Fatal-0.014/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/LTqqzI7RUJ/Test-Fatal-0.014/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Ap9SgpYylM/Test-RequiresInternet-0.05/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Ap9SgpYylM/Test-RequiresInternet-0.05/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/sjiLFNd7Kl/WWW-RobotRules-6.02/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/sjiLFNd7Kl/WWW-RobotRules-6.02/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/pdZfYhSW_L/libwww-perl-6.31/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/pdZfYhSW_L/libwww-perl-6.31/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/HnoSStQtTD/Digest-MD5-File-0.08/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/HnoSStQtTD/Digest-MD5-File-0.08/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/5mlEn6eoRE/Env-Path-0.19/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/5mlEn6eoRE/Env-Path-0.19/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/IVBiH4c2PG/Number-Compare-0.03/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/IVBiH4c2PG/Number-Compare-0.03/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/V0RH9L_GIC/Text-Glob-0.11/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/V0RH9L_GIC/Text-Glob-0.11/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Hw5NqG2E2Z/File-Find-Rule-0.34/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Hw5NqG2E2Z/File-Find-Rule-0.34/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/P5tOJimkb_/File-Grep-0.02/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/P5tOJimkb_/File-Grep-0.02/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/BWhrlFnxfc/Test-Warnings-0.026/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/BWhrlFnxfc/Test-Warnings-0.026/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/XHdinlsBj9/File-Slurper-0.011/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/XHdinlsBj9/File-Slurper-0.011/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/g4XmKruF9O/File-Which-1.22/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/g4XmKruF9O/File-Which-1.22/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wGk9zwtdif/Graph-0.9704/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wGk9zwtdif/Graph-0.9704/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/R2sztLXby2/Parse-Yapp-1.21/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/R2sztLXby2/Parse-Yapp-1.21/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/p5u70DUkHc/XML-Parser-2.44/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/p5u70DUkHc/XML-Parser-2.44/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7Sk3rz5o2w/XML-Writer-0.625/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7Sk3rz5o2w/XML-Writer-0.625/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/nQ9triWMeO/Graph-ReadWrite-2.09/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/nQ9triWMeO/Graph-ReadWrite-2.09/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Emial2qGlE/Log-Log4perl-1.49/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Emial2qGlE/Log-Log4perl-1.49/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eQrpvmfDof/Module-Runtime-0.016/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eQrpvmfDof/Module-Runtime-0.016/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/upeu8WvUzZ/Dist-CheckConflicts-0.11/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/upeu8WvUzZ/Dist-CheckConflicts-0.11/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DsGmyIr1KO/CPAN-Meta-Check-0.014/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DsGmyIr1KO/CPAN-Meta-Check-0.014/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/zgtybozy0M/Params-Util-1.07/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/zgtybozy0M/Params-Util-1.07/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/EI8dMOO9Yy/Sub-Install-0.928/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/EI8dMOO9Yy/Sub-Install-0.928/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DkkjUuNHSn/Data-OptList-0.110/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DkkjUuNHSn/Data-OptList-0.110/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/51qs8YlCmg/Test-Requires-0.10/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/51qs8YlCmg/Test-Requires-0.10/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/uTYblVDahh/Module-Implementation-0.09/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/uTYblVDahh/Module-Implementation-0.09/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/byIa9ADinJ/Package-Stash-XS-0.28/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/byIa9ADinJ/Package-Stash-XS-0.28/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qOMMN1Fg0h/Package-Stash-0.37/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qOMMN1Fg0h/Package-Stash-0.37/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DeDfzugltP/Class-Load-0.24/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DeDfzugltP/Class-Load-0.24/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eLDssxjXI0/Class-Load-XS-0.10/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eLDssxjXI0/Class-Load-XS-0.10/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/OEpSHE5dvf/Sub-Exporter-Progressive-0.001013/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/OEpSHE5dvf/Sub-Exporter-Progressive-0.001013/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8F_G_OfefG/Devel-GlobalDestruction-0.14/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8F_G_OfefG/Devel-GlobalDestruction-0.14/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qq0Hqxl1Oc/MRO-Compat-0.13/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qq0Hqxl1Oc/MRO-Compat-0.13/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qvvEh8g69A/Sub-Identify-0.14/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qvvEh8g69A/Sub-Identify-0.14/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/U4mG1K6eLS/Devel-OverloadInfo-0.004/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/U4mG1K6eLS/Devel-OverloadInfo-0.004/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/aYTlsE1egK/Eval-Closure-0.14/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/aYTlsE1egK/Eval-Closure-0.14/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Itqsg5iSNc/Module-Runtime-Conflicts-0.003/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Itqsg5iSNc/Module-Runtime-Conflicts-0.003/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/XXnmiwbh7L/Sub-Name-0.21/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/XXnmiwbh7L/Sub-Name-0.21/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AHJTxkARto/Package-DeprecationManager-0.17/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AHJTxkARto/Package-DeprecationManager-0.17/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eTHMmlT9es/Sub-Exporter-0.987/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eTHMmlT9es/Sub-Exporter-0.987/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/4yRCiYyHAc/File-pushd-1.014/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/4yRCiYyHAc/File-pushd-1.014/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wvyDyElHkt/Devel-Hide-0.0009/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wvyDyElHkt/Devel-Hide-0.0009/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/boT5KfT3C_/Variable-Magic-0.62/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/boT5KfT3C_/Variable-Magic-0.62/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/OytRewswC6/B-Hooks-EndOfScope-0.21/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/OytRewswC6/B-Hooks-EndOfScope-0.21/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TAf3PA8zqK/namespace-clean-0.27/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TAf3PA8zqK/namespace-clean-0.27/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TagwvmY7wD/Test-CleanNamespaces-0.22/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TagwvmY7wD/Test-CleanNamespaces-0.22/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/5adRf56_PT/PerlIO-utf8_strict-0.007/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/5adRf56_PT/PerlIO-utf8_strict-0.007/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Hn28OiO2us/Test-Files-0.14/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Hn28OiO2us/Test-Files-0.14/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/q9r4V1JR39/Test-Output-1.031/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/q9r4V1JR39/Test-Output-1.031/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/t8AUKV3hI4/Text-CSV-1.95/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/t8AUKV3hI4/Text-CSV-1.95/blib/arch:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/lib:/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/arch"
PERL5_CPANPLUS_IS_RUNNING="93569"
PERL5_CPANPLUS_IS_VERSION="0.9172"
PERL5_MINISMOKEBOX="0.68"
PERL5_YACSMOKE_BASE="/usr/home/cpan/pit/rel/conf/perl-5.24.3"
PERL_EXTUTILS_AUTOINSTALL="--defaultdeps"
PERL_MM_USE_DEFAULT="1"
@INC:
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wKjoNZlYD8/Array-Utils-0.5/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wKjoNZlYD8/Array-Utils-0.5/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/csPDMZBEge/IO-String-1.08/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/csPDMZBEge/IO-String-1.08/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/cgq974pxNY/Data-Stag-0.14/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/cgq974pxNY/Data-Stag-0.14/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/JIitCyx3QN/Class-Data-Inheritable-0.08/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/JIitCyx3QN/Class-Data-Inheritable-0.08/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NUnag6eyaY/Devel-StackTrace-2.03/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NUnag6eyaY/Devel-StackTrace-2.03/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/VFbW50SJgd/Exception-Class-1.44/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/VFbW50SJgd/Exception-Class-1.44/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7aR3xe5mwu/Test-Deep-1.127/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7aR3xe5mwu/Test-Deep-1.127/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/LaLhyxURN_/Capture-Tiny-0.46/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/LaLhyxURN_/Capture-Tiny-0.46/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Cc5kY9II6V/Algorithm-Diff-1.1903/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Cc5kY9II6V/Algorithm-Diff-1.1903/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Wl6K1pH0Gr/Text-Diff-1.45/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Wl6K1pH0Gr/Text-Diff-1.45/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/k4rCoWCsFK/Test-Differences-0.64/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/k4rCoWCsFK/Test-Differences-0.64/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/_1d0y3HqjO/Sub-Uplevel-0.2800/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/_1d0y3HqjO/Sub-Uplevel-0.2800/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/VsWSCckR3W/Test-Exception-0.43/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/VsWSCckR3W/Test-Exception-0.43/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8DKwkZbaX7/Test-Warn-0.32/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8DKwkZbaX7/Test-Warn-0.32/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/GpVL33ROhK/Test-Most-0.35/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/GpVL33ROhK/Test-Most-0.35/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/f3oe0CkdOq/Test-Needs-0.002005/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/f3oe0CkdOq/Test-Needs-0.002005/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/lLVgVUY0D4/URI-1.73/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/lLVgVUY0D4/URI-1.73/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NmhSVoT5RE/BioPerl-1.007002/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NmhSVoT5RE/BioPerl-1.007002/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/ODwTAr3ajL/Encode-Locale-1.05/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/ODwTAr3ajL/Encode-Locale-1.05/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8wg4_LR2nR/HTTP-Date-6.02/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8wg4_LR2nR/HTTP-Date-6.02/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NtuIn4aJa8/File-Listing-6.04/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/NtuIn4aJa8/File-Listing-6.04/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/ToyI8Qbz5D/HTML-Tagset-3.20/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/ToyI8Qbz5D/HTML-Tagset-3.20/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/EanaavVHRk/HTML-Parser-3.72/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/EanaavVHRk/HTML-Parser-3.72/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/0_U7StK_zP/IO-HTML-1.001/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/0_U7StK_zP/IO-HTML-1.001/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/zAMsfEN7FT/LWP-MediaTypes-6.02/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/zAMsfEN7FT/LWP-MediaTypes-6.02/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/gAeNoFaZH2/Try-Tiny-0.30/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/gAeNoFaZH2/Try-Tiny-0.30/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TwGV1cXF2W/HTTP-Message-6.14/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TwGV1cXF2W/HTTP-Message-6.14/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7O5JsUjph0/HTTP-Cookies-6.04/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7O5JsUjph0/HTTP-Cookies-6.04/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Uld1yEEV0E/HTTP-Daemon-6.01/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Uld1yEEV0E/HTTP-Daemon-6.01/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/U2jATQhoVq/HTTP-Negotiate-6.01/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/U2jATQhoVq/HTTP-Negotiate-6.01/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/UhbxO70_18/Net-HTTP-6.17/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/UhbxO70_18/Net-HTTP-6.17/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/LTqqzI7RUJ/Test-Fatal-0.014/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/LTqqzI7RUJ/Test-Fatal-0.014/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Ap9SgpYylM/Test-RequiresInternet-0.05/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Ap9SgpYylM/Test-RequiresInternet-0.05/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/sjiLFNd7Kl/WWW-RobotRules-6.02/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/sjiLFNd7Kl/WWW-RobotRules-6.02/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/pdZfYhSW_L/libwww-perl-6.31/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/pdZfYhSW_L/libwww-perl-6.31/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/HnoSStQtTD/Digest-MD5-File-0.08/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/HnoSStQtTD/Digest-MD5-File-0.08/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/5mlEn6eoRE/Env-Path-0.19/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/5mlEn6eoRE/Env-Path-0.19/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/IVBiH4c2PG/Number-Compare-0.03/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/IVBiH4c2PG/Number-Compare-0.03/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/V0RH9L_GIC/Text-Glob-0.11/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/V0RH9L_GIC/Text-Glob-0.11/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Hw5NqG2E2Z/File-Find-Rule-0.34/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Hw5NqG2E2Z/File-Find-Rule-0.34/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/P5tOJimkb_/File-Grep-0.02/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/P5tOJimkb_/File-Grep-0.02/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/BWhrlFnxfc/Test-Warnings-0.026/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/BWhrlFnxfc/Test-Warnings-0.026/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/XHdinlsBj9/File-Slurper-0.011/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/XHdinlsBj9/File-Slurper-0.011/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/g4XmKruF9O/File-Which-1.22/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/g4XmKruF9O/File-Which-1.22/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wGk9zwtdif/Graph-0.9704/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wGk9zwtdif/Graph-0.9704/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/R2sztLXby2/Parse-Yapp-1.21/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/R2sztLXby2/Parse-Yapp-1.21/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/p5u70DUkHc/XML-Parser-2.44/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/p5u70DUkHc/XML-Parser-2.44/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7Sk3rz5o2w/XML-Writer-0.625/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/7Sk3rz5o2w/XML-Writer-0.625/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/nQ9triWMeO/Graph-ReadWrite-2.09/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/nQ9triWMeO/Graph-ReadWrite-2.09/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Emial2qGlE/Log-Log4perl-1.49/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Emial2qGlE/Log-Log4perl-1.49/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eQrpvmfDof/Module-Runtime-0.016/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eQrpvmfDof/Module-Runtime-0.016/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/upeu8WvUzZ/Dist-CheckConflicts-0.11/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/upeu8WvUzZ/Dist-CheckConflicts-0.11/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DsGmyIr1KO/CPAN-Meta-Check-0.014/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DsGmyIr1KO/CPAN-Meta-Check-0.014/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/zgtybozy0M/Params-Util-1.07/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/zgtybozy0M/Params-Util-1.07/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/EI8dMOO9Yy/Sub-Install-0.928/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/EI8dMOO9Yy/Sub-Install-0.928/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DkkjUuNHSn/Data-OptList-0.110/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DkkjUuNHSn/Data-OptList-0.110/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/51qs8YlCmg/Test-Requires-0.10/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/51qs8YlCmg/Test-Requires-0.10/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/uTYblVDahh/Module-Implementation-0.09/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/uTYblVDahh/Module-Implementation-0.09/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/byIa9ADinJ/Package-Stash-XS-0.28/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/byIa9ADinJ/Package-Stash-XS-0.28/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qOMMN1Fg0h/Package-Stash-0.37/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qOMMN1Fg0h/Package-Stash-0.37/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DeDfzugltP/Class-Load-0.24/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/DeDfzugltP/Class-Load-0.24/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eLDssxjXI0/Class-Load-XS-0.10/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eLDssxjXI0/Class-Load-XS-0.10/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/OEpSHE5dvf/Sub-Exporter-Progressive-0.001013/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/OEpSHE5dvf/Sub-Exporter-Progressive-0.001013/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8F_G_OfefG/Devel-GlobalDestruction-0.14/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/8F_G_OfefG/Devel-GlobalDestruction-0.14/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qq0Hqxl1Oc/MRO-Compat-0.13/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qq0Hqxl1Oc/MRO-Compat-0.13/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qvvEh8g69A/Sub-Identify-0.14/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/qvvEh8g69A/Sub-Identify-0.14/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/U4mG1K6eLS/Devel-OverloadInfo-0.004/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/U4mG1K6eLS/Devel-OverloadInfo-0.004/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/aYTlsE1egK/Eval-Closure-0.14/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/aYTlsE1egK/Eval-Closure-0.14/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Irar7Swfnh/Scalar-List-Utils-1.49/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Itqsg5iSNc/Module-Runtime-Conflicts-0.003/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Itqsg5iSNc/Module-Runtime-Conflicts-0.003/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/XXnmiwbh7L/Sub-Name-0.21/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/XXnmiwbh7L/Sub-Name-0.21/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AHJTxkARto/Package-DeprecationManager-0.17/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AHJTxkARto/Package-DeprecationManager-0.17/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eTHMmlT9es/Sub-Exporter-0.987/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/eTHMmlT9es/Sub-Exporter-0.987/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/4yRCiYyHAc/File-pushd-1.014/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/4yRCiYyHAc/File-pushd-1.014/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wvyDyElHkt/Devel-Hide-0.0009/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/wvyDyElHkt/Devel-Hide-0.0009/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/boT5KfT3C_/Variable-Magic-0.62/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/boT5KfT3C_/Variable-Magic-0.62/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/OytRewswC6/B-Hooks-EndOfScope-0.21/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/OytRewswC6/B-Hooks-EndOfScope-0.21/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TAf3PA8zqK/namespace-clean-0.27/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TAf3PA8zqK/namespace-clean-0.27/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TagwvmY7wD/Test-CleanNamespaces-0.22/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/TagwvmY7wD/Test-CleanNamespaces-0.22/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/l3sU_zZogV/Moose-2.2009/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/5adRf56_PT/PerlIO-utf8_strict-0.007/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/5adRf56_PT/PerlIO-utf8_strict-0.007/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Hn28OiO2us/Test-Files-0.14/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/Hn28OiO2us/Test-Files-0.14/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/q9r4V1JR39/Test-Output-1.031/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/q9r4V1JR39/Test-Output-1.031/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/t8AUKV3hI4/Text-CSV-1.95/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/t8AUKV3hI4/Text-CSV-1.95/blib/arch
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/lib
/usr/home/cpan/pit/rel/conf/perl-5.24.3/.cpanplus/5.24.3/build/AwDY5zdkeY/Bio-Roary-3.11.1/blib/arch
/usr/home/cpan/pit/rel/perl-5.24.3/lib/site_perl/5.24.3/i386-freebsd-thread-multi-64int
/usr/home/cpan/pit/rel/perl-5.24.3/lib/site_perl/5.24.3
/usr/home/cpan/pit/rel/perl-5.24.3/lib/5.24.3/i386-freebsd-thread-multi-64int
/usr/home/cpan/pit/rel/perl-5.24.3/lib/5.24.3
.