Bio-Roary v3.10.0 Perl 5 v5.26.0 x86_64-linux-thread-multi

Status
Fail
From
Chris Williams (BINGOS)
Dist
Bio-Roary v3.10.0
Platform
Perl 5 v5.26.0 x86_64-linux-thread-multi
Date
2017-09-08 15:55:41
ID
2a728dcc-94ae-11e7-a074-e1beba07c9dd
This distribution has been tested as part of the CPAN Testers
project, supporting the Perl programming language.  See
http://wiki.cpantesters.org/ for more information or email
questions to cpan-testers-discuss@perl.org


--

Dear AJPAGE,

This is a computer-generated error report created automatically by
CPANPLUS, version 0.9168. Testers personal comments may appear
at the end of this report.


Thank you for uploading your work to CPAN.  However, it appears that
there were some problems testing your distribution.

TEST RESULTS:

Below is the error stack from stage 'make test':

PERL_DL_NONLAZY=1 "/home/cpan/pit/thr/perl-5.26.0/bin/perl" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(0, 'blib/lib', 'blib/arch')" t/*.t t/Bio/Roary/*.t t/Bio/Roary/CommandLine/*.t t/Bio/Roary/External/*.t t/Bio/Roary/Output/*.t t/Bio/Roary/QC/*.t

#   Failed test 'blastp in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'makeblastdb in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'mcl in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'mcxdeblast in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'bedtools in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'prank in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'parallel in PATH'
#   at t/00_requires_external.t line 19.

#   Failed test 'mafft in PATH'
#   at t/00_requires_external.t line 19.
# Looks like you failed 8 tests of 8.
t/00_requires_external.t ................................ 
Dubious, test returned 8 (wstat 2048, 0x800)
Failed 8/8 subtests 
t/Bio/Roary/AccessoryBinaryFasta.t ...................... ok
Cant open file: _accessory_clusters.clstr# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 2 just after 2.
t/Bio/Roary/AccessoryClustering.t ....................... 
Dubious, test returned 2 (wstat 512, 0x200)
All 2 subtests passed 
t/Bio/Roary/AnalyseGroups.t ............................. ok
t/Bio/Roary/AnnotateGroups.t ............................ ok
t/Bio/Roary/AssemblyStatistics.t ........................ ok
t/Bio/Roary/ChunkFastaFile.t ............................ ok
t/Bio/Roary/CombinedProteome.t .......................... ok

#   Failed test 'Actual output file exists example_annotation.gff.proteome.faa  -t 1 t/data/example_annotation.gff'
#   at t/lib/TestHelper.pm line 139.

#   Failed test 'Actual and expected output match for '-t 1 t/data/example_annotation.gff''
#   at t/lib/TestHelper.pm line 148.
# example_annotation.gff.proteome.faa absent

#   Failed test 'Actual output file exists example_annotation.gff.proteome.faa  t/data/example_annotation.gff'
#   at t/lib/TestHelper.pm line 139.

#   Failed test 'Actual and expected output match for 't/data/example_annotation.gff''
#   at t/lib/TestHelper.pm line 148.
# example_annotation.gff.proteome.faa absent
# Looks like you failed 4 tests of 7.
t/Bio/Roary/CommandLine/ExtractProteomeFromGff.t ........ 
Dubious, test returned 4 (wstat 1024, 0x400)
Failed 4/7 subtests 
t/Bio/Roary/CommandLine/GeneAlignmentFromNucleotides.t .. ok
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
t/Bio/Roary/CommandLine/ParallelAllAgainstAllBlastp.t ... ok
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
grep: /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/4O3lgQvw1S/query_1.gff.proteome.faa: No such file or directory
grep: /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/4O3lgQvw1S/query_2.gff.proteome.faa: No such file or directory
grep: /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/4O3lgQvw1S/query_3.gff.proteome.faa: No such file or directory
grep: /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/4O3lgQvw1S/query_1.gff.proteome.faa: No such file or directory
grep: /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/4O3lgQvw1S/query_2.gff.proteome.faa: No such file or directory
grep: /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/4O3lgQvw1S/query_3.gff.proteome.faa: No such file or directory
grep: /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/4O3lgQvw1S/query_1.gff.proteome.faa: No such file or directory
grep: /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/4O3lgQvw1S/query_2.gff.proteome.faa: No such file or directory
grep: /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/4O3lgQvw1S/query_3.gff.proteome.faa: No such file or directory
grep: /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/4O3lgQvw1S/query_1.gff.proteome.faa: No such file or directory
grep: /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/4O3lgQvw1S/query_2.gff.proteome.faa: No such file or directory
grep: /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/4O3lgQvw1S/query_3.gff.proteome.faa: No such file or directory

#   Failed test 'Actual and expected sorted output match for '-g t/data/query_groups -a difference   -i t/data/query_1.gff -t t/data/query_2.gff,t/data/query_3.gff''
#   at t/lib/TestHelper.pm line 38.
#     Structures begin differing at:
#          $got->[1] = Does not exist
#     $expected->[1] = ARRAY(0x585f490)
# Looks like you failed 1 test of 37.
t/Bio/Roary/CommandLine/QueryRoary.t .................... 
Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/37 subtests 
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)

#   Failed test 'Actual output file exists gene_presence_absence.csv   -j Local -t 1 --dont_split_groups t/data/genbank_gbff/genbank1.gff t/data/genbank_gbff/genbank2.gff t/data/genbank_gbff/genbank3.gff'
#   at /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/t/lib/TestHelper.pm line 249.
# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 2 just after 3.
t/Bio/Roary/CommandLine/Roary.t ......................... 
Dubious, test returned 2 (wstat 512, 0x200)
Failed 1/3 subtests 
t/Bio/Roary/CommandLine/RoaryCoreAlignment.t ............ ok
t/Bio/Roary/CommandLine/RoaryPostAnalysis.t ............. ok
t/Bio/Roary/CommandLine/RoaryReorderSpreadsheet.t ....... ok
t/Bio/Roary/CommandLine/TransferAnnotationToGroups.t .... ok
t/Bio/Roary/ContigsToGeneIDsFromGFF.t ................... ok
t/Bio/Roary/EmblGroups.t ................................ ok
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
t/Bio/Roary/External/Blastp.t ........................... ok
t/Bio/Roary/External/Cdhit.t ............................ ok

#   Failed test 'Check for parallel'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2017/09/08 16:55:28 ERROR: Can't find required 'parallel' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'parallel' - found )
# as expected

#   Failed test 'Check for blastp'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2017/09/08 16:55:28 ERROR: Can't find required 'blastp' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'blastp' - found )
# as expected

#   Failed test 'Check for makeblastdb'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2017/09/08 16:55:28 ERROR: Can't find required 'makeblastdb' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'makeblastdb' - found )
# as expected

#   Failed test 'Check for mcl'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2017/09/08 16:55:28 ERROR: Can't find required 'mcl' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'mcl' - found )
# as expected

#   Failed test 'Check for bedtools'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2017/09/08 16:55:28 ERROR: Can't find required 'bedtools' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'bedtools' - found )
# as expected

#   Failed test 'Check for prank'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2017/09/08 16:55:28 Optional tool 'prank' not found in your $PATH
# 
# doesn't match:
# (?^:Looking for 'prank' - found )
# as expected

#   Failed test 'Check for mafft'
#   at t/Bio/Roary/External/CheckTools.t line 17.
# STDERR:
# 2017/09/08 16:55:28 ERROR: Can't find required 'mafft' in your $PATH
# 
# doesn't match:
# (?^:Looking for 'mafft' - found )
# as expected
# Looks like you failed 7 tests of 13.
t/Bio/Roary/External/CheckTools.t ....................... 
Dubious, test returned 7 (wstat 1792, 0x700)
Failed 7/13 subtests 
sh: 1: mafft: not found

#   Failed test 'output for mafft matches'
#   at t/Bio/Roary/External/Mafft.t line 39.
# +---+-----+---+-----------------------------------------------------------------------------+
# |   |Got  |   |Expected                                                                     |
# | Ln|     | Ln|                                                                             |
# +---+-----+---+-----------------------------------------------------------------------------+
# |   |     *  1|>1111#5_04506                                                                *
# |   |     *  2|------------------------------------------------------------                 *
# |   |     *  3|------------------------------------------------------------                 *
# |   |     *  4|------------------------------------------------------------                 *
# |   |     *  5|------------------------------------------------------------                 *
# |   |     *  6|------------------------------------------------------------                 *
# |   |     *  7|------------------------------------------------------------                 *
# |   |     *  8|------------------------------------------------------------                 *
# |   |     *  9|---------atggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg                 *
# |   |     * 10|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 11|attgataataaagttcaaccgcttatcaggcgttga                                         *
# |   |     * 12|>1234_8#75_04759                                                             *
# |   |     * 13|atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa                 *
# |   |     * 14|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat                 *
# |   |     * 15|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg                 *
# |   |     * 16|ctggattctttccggcgggatagtgctttttatacctggttgtatcgtattgcggtcaat                 *
# |   |     * 17|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg                 *
# |   |     * 18|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac                 *
# |   |     * 19|ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa                 *
# |   |     * 20|gatttacgtatggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg                 *
# |   |     * 21|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 22|attgataataaagttcaaccgcttatcaggcgttga                                         *
# |   |     * 23|>Salmonella_enterica_subsp_enterica_serovar_Typhimurium_DT104_v1_02853       *
# |   |     * 24|atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa                 *
# |   |     * 25|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat                 *
# |   |     * 26|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg                 *
# |   |     * 27|ctggattctttccggggggatagtgctttttatacctggttgtatcgtattgcggtcaat                 *
# |   |     * 28|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg                 *
# |   |     * 29|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac                 *
# |   |     * 30|ttaatgttttcagaagaactgagacagatagttttccgaactattgagtccctcccggaa                 *
# |   |     * 31|gatttacgtatggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg                 *
# |   |     * 32|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 33|attgataataaagttcaaccgcttatcaggcgttga                                         *
# |   |     * 34|>Salmonella_enterica_subsp_enterica_serovar_Typhimurium_SL1344_v2_02736      *
# |   |     * 35|atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa                 *
# |   |     * 36|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat                 *
# |   |     * 37|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg                 *
# |   |     * 38|ctggattctttccggggggatagtgctttttatacctggttgtatcgtattgcggtcaat                 *
# |   |     * 39|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg                 *
# |   |     * 40|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac                 *
# |   |     * 41|ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa                 *
# |   |     * 42|gatttacgtatggcaatcaccttacgggagctggatggcctgagctgtgaagagatagcg                 *
# |   |     * 43|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 44|attgataataaagttcaaccgcttatcaggcgttga                                         *
# |   |     * 45|>Salmonella_enterica_subsp_enterica_serovar_Typhimurium_str_D23580_v1_02783  *
# |   |     * 46|atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa                 *
# |   |     * 47|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat                 *
# |   |     * 48|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg                 *
# |   |     * 49|ctggattctttccggggggatagtgctttttatacctggttgtatcgtattgcggtcaat                 *
# |   |     * 50|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg                 *
# |   |     * 51|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac                 *
# |   |     * 52|ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa                 *
# |   |     * 53|gatttacgtatggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg                 *
# |   |     * 54|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 55|attgataataaagttcaaccgcttatcaggcgttga                                         *
# |   |     * 56|>Salmonella_enterica_subsp_enterica_serovar_Typhimurium_str_DT2_v1_02741     *
# |   |     * 57|atgagcgagcagttaacggac---gtcctggttgaacgggtccagaagggagatcagaaa                 *
# |   |     * 58|gcctttaacttactggtagtgcgctaccagcataaagtggcgagtctggtttcccgctat                 *
# |   |     * 59|gtgccatcgggcgacgttcccgatgtcgtacaggaatcatttattaaggcctatcgcgcg                 *
# |   |     * 60|ctggattctttccggggggatagtgctttttatacctggttgtatcgtattgcggtcaat                 *
# |   |     * 61|accgcgaagaactacctggttgcgcaggggcgtcgtccgccttccagtgatgtagacgcg                 *
# |   |     * 62|attgaagcagaaaactttgaaagcggcggcgcgctgaaagaaatttcgaaccctgagaac                 *
# |   |     * 63|ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa                 *
# |   |     * 64|gatttacgtatggcaatcaccttacgggagctggatggcctgagctatgaagagatagcg                 *
# |   |     * 65|gctatcatggattgtccggtggggacggtgcgttcacgtatcttccgggcgcgggaagct                 *
# |   |     * 66|attgataataaagttcaaccgcttatcaggcgttga                                         *
# +---+-----+---+-----------------------------------------------------------------------------+
# Looks like you failed 1 test of 6.
t/Bio/Roary/External/Mafft.t ............................ 
Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/6 subtests 
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
t/Bio/Roary/External/Makeblastdb.t ...................... ok
2017/09/08 16:55:29 Cannot find the mcxdeblast executable, please ensure its in your PATH
# Tests were run but no plan was declared and done_testing() was not seen.
t/Bio/Roary/External/Mcl.t .............................. 
Dubious, test returned 254 (wstat 65024, 0xfe00)
All 5 subtests passed 

#   Failed test 'output file exists'
#   at t/Bio/Roary/External/Prank.t line 33.

------------- EXCEPTION -------------
MSG: Could not read file 't/data/prank_input.fa.aln': No such file or directory
STACK Bio::Root::IO::_initialize_io /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/z5fLql5TTh/BioPerl-1.007001/blib/lib/Bio/Root/IO.pm:268
STACK Bio::SeqIO::_initialize /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/z5fLql5TTh/BioPerl-1.007001/blib/lib/Bio/SeqIO.pm:513
STACK Bio::SeqIO::fasta::_initialize /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/z5fLql5TTh/BioPerl-1.007001/blib/lib/Bio/SeqIO/fasta.pm:87
STACK Bio::SeqIO::new /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/z5fLql5TTh/BioPerl-1.007001/blib/lib/Bio/SeqIO.pm:389
STACK Bio::SeqIO::new /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/z5fLql5TTh/BioPerl-1.007001/blib/lib/Bio/SeqIO.pm:435
STACK Bio::Roary::SortFasta::_build__input_seqio /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/blib/lib/Bio/Roary/SortFasta.pm:27
STACK Bio::Roary::SortFasta::_input_seqio reader Bio::Roary::SortFasta::_input_seqio (defined at /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/blib/lib/Bio/Roary/SortFasta.pm line 17):8
STACK Bio::Roary::SortFasta::sort_fasta /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/blib/lib/Bio/Roary/SortFasta.pm:68
STACK toplevel t/Bio/Roary/External/Prank.t:38
-------------------------------------

# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 2 just after 5.
t/Bio/Roary/External/Prank.t ............................ 
Dubious, test returned 2 (wstat 512, 0x200)
Failed 1/5 subtests 
t/Bio/Roary/ExtractCoreGenesFromSpreadsheet.t ........... ok
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)

#   Failed test 'content of proteome 1 as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 30.
# /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/AEBsud4dkJ/example_annotation.gff.proteome.faa absent
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)

#   Failed test 'content of proteome 1 as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 44.
# /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/AUSxsekt4D/example_annotation_2.gff.proteome.faa absent
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)

#   Failed test 'content of proteome /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/aQCtii8Yxh/genbank1.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 64.
# /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/aQCtii8Yxh/genbank1.gff.proteome.faa absent

#   Failed test 'content of proteome /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/aQCtii8Yxh/genbank2.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 64.
# /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/aQCtii8Yxh/genbank2.gff.proteome.faa absent

#   Failed test 'content of proteome /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/aQCtii8Yxh/genbank3.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 64.
# /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/aQCtii8Yxh/genbank3.gff.proteome.faa absent
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)

#   Failed test 'content of proteome /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/qBANr2oi09/query_1.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 87.
# /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/qBANr2oi09/query_1.gff.proteome.faa absent

#   Failed test 'content of proteome /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/qBANr2oi09/query_2.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 87.
# /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/qBANr2oi09/query_2.gff.proteome.faa absent

#   Failed test 'content of proteome /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/qBANr2oi09/query_3.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 87.
# /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/qBANr2oi09/query_3.gff.proteome.faa absent
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)

#   Failed test 'content of proteome /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/0t2HAHEj8f/annotation_1.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 112.
# /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/0t2HAHEj8f/annotation_1.gff.proteome.faa absent

#   Failed test 'content of proteome /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/0t2HAHEj8f/annotation_2.gff.proteome.faa as expected'
#   at t/Bio/Roary/ExtractProteomeFromGFFs.t line 112.
# /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/0t2HAHEj8f/annotation_2.gff.proteome.faa absent
# Looks like you failed 10 tests of 20.
t/Bio/Roary/ExtractProteomeFromGFFs.t ................... 
Dubious, test returned 10 (wstat 2560, 0xa00)
Failed 10/20 subtests 
t/Bio/Roary/FilterFullClusters.t ........................ ok
t/Bio/Roary/GeneNamesFromGFF.t .......................... ok
t/Bio/Roary/GroupLabels.t ............................... ok
t/Bio/Roary/GroupStatistics.t ........................... ok
t/Bio/Roary/InflateClusters.t ........................... ok
t/Bio/Roary/OrderGenes.t ................................ ok
t/Bio/Roary/Output/CoreGeneAlignmentCoorindatesEMBL.t ... ok
t/Bio/Roary/Output/DifferenceBetweenSets.t .............. ok
t/Bio/Roary/Output/GroupsMultifastaProtein.t ............ ok
t/Bio/Roary/Output/GroupsMultifastas.t .................. ok
Attribute (fasta_file) does not pass the type constraint because: Validation failed for 'Str' with value undef at reader Bio::Roary::Output::GroupsMultifastaNucleotide::fasta_file (defined at lib/Bio/Roary/Output/GroupsMultifastaNucleotide.pm line 29) line 15
	Bio::Roary::Output::GroupsMultifastaNucleotide::fasta_file('Bio::Roary::Output::GroupsMultifastaNucleotide=HASH(0x3645e70)') called at lib/Bio/Roary/Output/GroupsMultifastaNucleotide.pm line 43
	Bio::Roary::Output::GroupsMultifastaNucleotide::_build__input_seqio('Bio::Roary::Output::GroupsMultifastaNucleotide=HASH(0x3645e70)') called at reader Bio::Roary::Output::GroupsMultifastaNucleotide::_input_seqio (defined at lib/Bio/Roary/Output/GroupsMultifastaNucleotide.pm line 30) line 8
	Bio::Roary::Output::GroupsMultifastaNucleotide::_input_seqio('Bio::Roary::Output::GroupsMultifastaNucleotide=HASH(0x3645e70)') called at lib/Bio/Roary/Output/GroupsMultifastaNucleotide.pm line 53
	Bio::Roary::Output::GroupsMultifastaNucleotide::populate_files('Bio::Roary::Output::GroupsMultifastaNucleotide=HASH(0x3645e70)') called at lib/Bio/Roary/Output/GroupsMultifastasNucleotide.pm line 65
	Bio::Roary::Output::GroupsMultifastasNucleotide::create_files('Bio::Roary::Output::GroupsMultifastasNucleotide=HASH(0x37abf90)') called at t/Bio/Roary/Output/GroupsMultifastasNucleotide.t line 40
# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 127 just after 3.
t/Bio/Roary/Output/GroupsMultifastasNucleotide.t ........ 
Dubious, test returned 127 (wstat 32512, 0x7f00)
All 3 subtests passed 
t/Bio/Roary/Output/NumberOfGroups.t ..................... ok
t/Bio/Roary/Output/QueryGroups.t ........................ ok
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
t/Bio/Roary/ParallelAllAgainstAllBlast.t ................ ok
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
XS.c: loadable library and perl binaries are mismatched (got handshake key 0xde00080, needed 0xdb00080)
t/Bio/Roary/PrepareInputFiles.t ......................... ok
t/Bio/Roary/PresenceAbsenceMatrix.t ..................... ok
t/Bio/Roary/QC/Report.t ................................. ok
2017/09/08 16:55:38 Input file contains duplicate gene IDs, attempting to fix by adding a unique suffix, new GFF in the fixed_input_files directory: t/data/reformat_input_gffs/query_2.gff 
2017/09/08 16:55:38 Input file contains duplicate gene IDs, attempting to fix by adding a unique suffix, new GFF in the fixed_input_files directory: t/data/reformat_input_gffs/query_2.gff 
t/Bio/Roary/ReformatInputGFFs.t ......................... ok
t/Bio/Roary/ReorderSpreadsheet.t ........................ ok
t/Bio/Roary/SampleOrder.t ............................... ok
t/Bio/Roary/SequenceLengths.t ........................... ok
t/Bio/Roary/SortFasta.t ................................. ok
t/Bio/Roary/SplitGroups.t ............................... ok
t/Bio/Roary/UniqueGenesPerSample.t ...................... ok

Test Summary Report
-------------------
t/00_requires_external.t                              (Wstat: 2048 Tests: 8 Failed: 8)
  Failed tests:  1-8
  Non-zero exit status: 8
t/Bio/Roary/AccessoryClustering.t                     (Wstat: 512 Tests: 2 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Bio/Roary/CommandLine/ExtractProteomeFromGff.t      (Wstat: 1024 Tests: 7 Failed: 4)
  Failed tests:  4-7
  Non-zero exit status: 4
t/Bio/Roary/CommandLine/QueryRoary.t                  (Wstat: 256 Tests: 37 Failed: 1)
  Failed test:  27
  Non-zero exit status: 1
t/Bio/Roary/CommandLine/Roary.t                       (Wstat: 512 Tests: 3 Failed: 1)
  Failed test:  3
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Bio/Roary/External/CheckTools.t                     (Wstat: 1792 Tests: 13 Failed: 7)
  Failed tests:  3-9
  Non-zero exit status: 7
t/Bio/Roary/External/Mafft.t                          (Wstat: 256 Tests: 6 Failed: 1)
  Failed test:  6
  Non-zero exit status: 1
t/Bio/Roary/External/Mcl.t                            (Wstat: 65024 Tests: 5 Failed: 0)
  Non-zero exit status: 254
  Parse errors: No plan found in TAP output
t/Bio/Roary/External/Prank.t                          (Wstat: 512 Tests: 5 Failed: 1)
  Failed test:  5
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Bio/Roary/ExtractProteomeFromGFFs.t                 (Wstat: 2560 Tests: 20 Failed: 10)
  Failed tests:  4, 6, 9-11, 14-16, 19-20
  Non-zero exit status: 10
t/Bio/Roary/Output/GroupsMultifastasNucleotide.t      (Wstat: 32512 Tests: 3 Failed: 0)
  Non-zero exit status: 127
  Parse errors: No plan found in TAP output
Files=52, Tests=675, 24 wallclock secs ( 0.21 usr  0.03 sys + 16.35 cusr  5.31 csys = 21.90 CPU)
Result: FAIL
Failed 11/52 test programs. 33/675 subtests failed.
Makefile:1395: recipe for target 'test_dynamic' failed
make: *** [test_dynamic] Error 255


PREREQUISITES:

Here is a list of prerequisites you specified and versions we
managed to load:

	  Module Name                        Have     Want
	  Array::Utils                        0.5        0
	  Bio::Perl                             0        0
	  Bio::SeqIO                            0        0
	  Bio::Tools::GFF                       0        0
	  Bio::TreeIO                           0        0
	  Cwd                                3.67        0
	  Data::Dumper                      2.167        0
	  Digest::MD5::File                  0.08        0
	  Env::Path                          0.19        0
	  Exception::Class                   1.43        0
	  ExtUtils::MakeMaker                7.30        0
	  File::Basename                     2.85        0
	  File::Copy                         2.32        0
	  File::Find::Rule                   0.34        0
	  File::Grep                         0.02        0
	  File::Path                         2.14        0
	  File::Slurper                     0.009        0
	  File::Spec                         3.67        0
	  File::Temp                       0.2304        0
	  File::Which                        1.21        0
	  FindBin                            1.51        0
	  Getopt::Long                       2.49        0
	  Graph                            0.9704        0
	  Graph::Writer::Dot                 2.09        0
	  List::Util                      1.46_02        0
	  Log::Log4perl                      1.49        0
	  Moose                            2.2006        0
	  Moose::Role                      2.2006        0
	  POSIX                              1.76        0
	  PerlIO::utf8_strict               0.007        0
	  Test::Files                        0.14        0
	  Test::Most                         0.35        0
	  Test::Output                      1.031        0
	  Text::CSV                          1.95        0
	  strict                             1.11        0
	  warnings                           1.37        0

Perl module toolchain versions installed:
	Module Name                        Have
	CPANPLUS                         0.9168
	CPANPLUS::Dist::Build              0.88
	Cwd                                3.67
	ExtUtils::CBuilder             0.280226
	ExtUtils::Command                  7.30
	ExtUtils::Install                  2.14
	ExtUtils::MakeMaker                7.30
	ExtUtils::Manifest                 1.70
	ExtUtils::ParseXS                  3.34
	File::Spec                         3.67
	Module::Build                    0.4224
	Pod::Parser                        1.63
	Pod::Simple                        3.35
	Test2                          1.302086
	Test::Harness                      3.39
	Test::More                     1.302086
	version                          0.9918

******************************** NOTE ********************************
The comments above are created mechanically, possibly without manual
checking by the sender.  As there are many people performing automatic
tests on each upload to CPAN, it is likely that you will receive
identical messages about the same problem.

If you believe that the message is mistaken, please reply to the first
one with correction and/or additional informations, and do not take
it personally.  We appreciate your patience. :)
**********************************************************************

Additional comments:


This report was machine-generated by CPANPLUS::Dist::YACSmoke 1.02.
Powered by minismokebox version 0.68

------------------------------
ENVIRONMENT AND OTHER CONTEXT
------------------------------

Environment variables:

    AUTOMATED_TESTING = 1
    LANG = en_GB.UTF-8
    LANGUAGE = en_GB:en
    NONINTERACTIVE_TESTING = 1
    PATH = /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/blib/script:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/DVKcKr6_T_/Moose-2.2006/blib/script:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/L3_7g8jfro/Package-Stash-0.37/blib/script:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ND0u4h19Po/Log-Log4perl-1.49/blib/script:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/D0leUqJFbi/Parse-Yapp-1.21/blib/script:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/VKCkQCzPvO/File-Find-Rule-0.34/blib/script:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/w4IdhuxZGt/Env-Path-0.19/blib/script:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/uo91VW72To/libwww-perl-6.26/blib/script:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/z5fLql5TTh/BioPerl-1.007001/blib/script:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9nTFSLMpYZ/Data-Stag-0.14/blib/script:/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/usr/local/games:/snap/bin
    PERL5LIB = :/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/yAoe5PnQ1y/Array-Utils-0.5/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/yAoe5PnQ1y/Array-Utils-0.5/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jG_2KAufWf/IO-String-1.08/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jG_2KAufWf/IO-String-1.08/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9nTFSLMpYZ/Data-Stag-0.14/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9nTFSLMpYZ/Data-Stag-0.14/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/UFiAMQhT9D/Class-Data-Inheritable-0.08/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/UFiAMQhT9D/Class-Data-Inheritable-0.08/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/MB95d7iFrS/Devel-StackTrace-2.02/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/MB95d7iFrS/Devel-StackTrace-2.02/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Clw7edKudf/Exception-Class-1.43/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Clw7edKudf/Exception-Class-1.43/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/MqKJwsJ3l7/Test-Deep-1.127/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/MqKJwsJ3l7/Test-Deep-1.127/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/3wawmIqyum/Capture-Tiny-0.46/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/3wawmIqyum/Capture-Tiny-0.46/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/RQ6BqiXOBP/Algorithm-Diff-1.1903/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/RQ6BqiXOBP/Algorithm-Diff-1.1903/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/kXXvdTMqU9/Text-Diff-1.45/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/kXXvdTMqU9/Text-Diff-1.45/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/zofFeiKCzX/Test-Differences-0.64/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/zofFeiKCzX/Test-Differences-0.64/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9X92JSK1jw/Sub-Uplevel-0.2800/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9X92JSK1jw/Sub-Uplevel-0.2800/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/hnNOTiihl_/Test-Exception-0.43/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/hnNOTiihl_/Test-Exception-0.43/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ruWbdLDexU/Test-Warn-0.32/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ruWbdLDexU/Test-Warn-0.32/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jjuSxIzSCh/Test-Most-0.35/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jjuSxIzSCh/Test-Most-0.35/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efBZkFB86z/Test-Needs-0.002005/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efBZkFB86z/Test-Needs-0.002005/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/FQB1GHNv2V/URI-1.72/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/FQB1GHNv2V/URI-1.72/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/z5fLql5TTh/BioPerl-1.007001/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/z5fLql5TTh/BioPerl-1.007001/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/43LvCvo7ow/Encode-Locale-1.05/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/43LvCvo7ow/Encode-Locale-1.05/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/pof4tlM1WT/HTTP-Date-6.02/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/pof4tlM1WT/HTTP-Date-6.02/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/bkRwwnylMz/File-Listing-6.04/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/bkRwwnylMz/File-Listing-6.04/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/gLEUfkrGLl/HTML-Tagset-3.20/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/gLEUfkrGLl/HTML-Tagset-3.20/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ShpPyXhPi9/HTML-Parser-3.72/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ShpPyXhPi9/HTML-Parser-3.72/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/I1hEmFNWY9/IO-HTML-1.001/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/I1hEmFNWY9/IO-HTML-1.001/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/HtY4HQQYXx/LWP-MediaTypes-6.02/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/HtY4HQQYXx/LWP-MediaTypes-6.02/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Wb7u7rPGLI/Try-Tiny-0.28/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Wb7u7rPGLI/Try-Tiny-0.28/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/XTSyJRbrXU/HTTP-Message-6.13/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/XTSyJRbrXU/HTTP-Message-6.13/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/qf9w5Oya88/HTTP-Cookies-6.04/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/qf9w5Oya88/HTTP-Cookies-6.04/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/cCdNQ2OqWh/HTTP-Daemon-6.01/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/cCdNQ2OqWh/HTTP-Daemon-6.01/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/v1AuINkNNI/HTTP-Negotiate-6.01/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/v1AuINkNNI/HTTP-Negotiate-6.01/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/chJm9pRS8Q/Net-HTTP-6.17/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/chJm9pRS8Q/Net-HTTP-6.17/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Mzbs00VqAL/Test-Fatal-0.014/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Mzbs00VqAL/Test-Fatal-0.014/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/EATOiX85je/Test-RequiresInternet-0.05/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/EATOiX85je/Test-RequiresInternet-0.05/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/BGlj9lMm0S/WWW-RobotRules-6.02/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/BGlj9lMm0S/WWW-RobotRules-6.02/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/uo91VW72To/libwww-perl-6.26/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/uo91VW72To/libwww-perl-6.26/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/BLEFsQjpmC/Digest-MD5-File-0.08/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/BLEFsQjpmC/Digest-MD5-File-0.08/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/w4IdhuxZGt/Env-Path-0.19/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/w4IdhuxZGt/Env-Path-0.19/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/v4lQE6hPyQ/Number-Compare-0.03/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/v4lQE6hPyQ/Number-Compare-0.03/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/DmmBkkMmuT/Text-Glob-0.11/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/DmmBkkMmuT/Text-Glob-0.11/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/VKCkQCzPvO/File-Find-Rule-0.34/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/VKCkQCzPvO/File-Find-Rule-0.34/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/teAh9ZvRcu/File-Grep-0.02/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/teAh9ZvRcu/File-Grep-0.02/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/hr6a9PPaCE/Test-Warnings-0.026/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/hr6a9PPaCE/Test-Warnings-0.026/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/soXZ5Lfz7p/File-Slurper-0.009/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/soXZ5Lfz7p/File-Slurper-0.009/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Ul3Fd19hLr/File-Which-1.21/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Ul3Fd19hLr/File-Which-1.21/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/eFmsusDbKR/Graph-0.9704/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/eFmsusDbKR/Graph-0.9704/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/D0leUqJFbi/Parse-Yapp-1.21/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/D0leUqJFbi/Parse-Yapp-1.21/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/505dqBedmq/XML-Parser-2.44/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/505dqBedmq/XML-Parser-2.44/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/UfbKZ4To31/XML-Writer-0.625/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/UfbKZ4To31/XML-Writer-0.625/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/J75f61IecL/Graph-ReadWrite-2.09/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/J75f61IecL/Graph-ReadWrite-2.09/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ND0u4h19Po/Log-Log4perl-1.49/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ND0u4h19Po/Log-Log4perl-1.49/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/zLmD6ByVfS/Module-Runtime-0.015/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/zLmD6ByVfS/Module-Runtime-0.015/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/e1a6AZ8p2W/Dist-CheckConflicts-0.11/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/e1a6AZ8p2W/Dist-CheckConflicts-0.11/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jjp_3VIaMA/CPAN-Meta-Check-0.014/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jjp_3VIaMA/CPAN-Meta-Check-0.014/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/XjtD7Zz6kU/Params-Util-1.07/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/XjtD7Zz6kU/Params-Util-1.07/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9PakkP6l0R/Sub-Install-0.928/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9PakkP6l0R/Sub-Install-0.928/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/azR33pI4_5/Data-OptList-0.110/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/azR33pI4_5/Data-OptList-0.110/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/qWW1CEfYpU/Test-Requires-0.10/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/qWW1CEfYpU/Test-Requires-0.10/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/a3E8Tefju9/Module-Implementation-0.09/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/a3E8Tefju9/Module-Implementation-0.09/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/dIAF1bZnbf/Package-Stash-XS-0.28/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/dIAF1bZnbf/Package-Stash-XS-0.28/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/L3_7g8jfro/Package-Stash-0.37/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/L3_7g8jfro/Package-Stash-0.37/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/6yuZUtmLCh/Class-Load-0.24/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/6yuZUtmLCh/Class-Load-0.24/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/aP0ZLVRys2/Class-Load-XS-0.10/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/aP0ZLVRys2/Class-Load-XS-0.10/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/NZ4t9GgG3C/Sub-Exporter-Progressive-0.001013/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/NZ4t9GgG3C/Sub-Exporter-Progressive-0.001013/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Ppzgf_DwHW/Devel-GlobalDestruction-0.14/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Ppzgf_DwHW/Devel-GlobalDestruction-0.14/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/8AQnq1soT7/MRO-Compat-0.13/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/8AQnq1soT7/MRO-Compat-0.13/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/pNb6udRatM/Sub-Identify-0.14/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/pNb6udRatM/Sub-Identify-0.14/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/L4CSv85tPm/Devel-OverloadInfo-0.004/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/L4CSv85tPm/Devel-OverloadInfo-0.004/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/lKMYO88b94/Eval-Closure-0.14/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/lKMYO88b94/Eval-Closure-0.14/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Zh64wsXnxf/Module-Runtime-Conflicts-0.003/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Zh64wsXnxf/Module-Runtime-Conflicts-0.003/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/0XHp9ijWN6/Sub-Name-0.21/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/0XHp9ijWN6/Sub-Name-0.21/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/vbCadDRyZl/Package-DeprecationManager-0.17/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/vbCadDRyZl/Package-DeprecationManager-0.17/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/V0evX_VkWG/Sub-Exporter-0.987/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/V0evX_VkWG/Sub-Exporter-0.987/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/B3TnHrp82W/File-pushd-1.014/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/B3TnHrp82W/File-pushd-1.014/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/G1weerXMQR/Devel-Hide-0.0009/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/G1weerXMQR/Devel-Hide-0.0009/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/3vRtowQ63x/Variable-Magic-0.61/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/3vRtowQ63x/Variable-Magic-0.61/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/5oRNcg6PIu/B-Hooks-EndOfScope-0.21/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/5oRNcg6PIu/B-Hooks-EndOfScope-0.21/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/xhTtpZUCuQ/namespace-clean-0.27/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/xhTtpZUCuQ/namespace-clean-0.27/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/51z53C05TK/Test-CleanNamespaces-0.22/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/51z53C05TK/Test-CleanNamespaces-0.22/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/DVKcKr6_T_/Moose-2.2006/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/DVKcKr6_T_/Moose-2.2006/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/0RDB6_OB9o/PerlIO-utf8_strict-0.007/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/0RDB6_OB9o/PerlIO-utf8_strict-0.007/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/CoSa1mQHbc/Test-Files-0.14/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/CoSa1mQHbc/Test-Files-0.14/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/GUdg8HfqFW/Test-Output-1.031/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/GUdg8HfqFW/Test-Output-1.031/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/sjfmoDg5ad/Text-CSV-1.95/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/sjfmoDg5ad/Text-CSV-1.95/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/blib/arch
    PERL5_CPANPLUS_IS_RUNNING = 26471
    PERL5_CPANPLUS_IS_VERSION = 0.9168
    PERL5_MINISMOKEBOX = 0.68
    PERL5_YACSMOKE_BASE = /home/cpan/pit/thr/conf/perl-5.26.0
    PERL_EXTUTILS_AUTOINSTALL = --defaultdeps
    PERL_MM_USE_DEFAULT = 1
    SHELL = /bin/bash
    TERM = screen

Perl special variables (and OS-specific diagnostics, for MSWin32):

    Perl: $^X = /home/cpan/pit/thr/perl-5.26.0/bin/perl
    UID:  $<  = 1001
    EUID: $>  = 1001
    GID:  $(  = 1001 1001
    EGID: $)  = 1001 1001


-------------------------------


--

Summary of my perl5 (revision 5 version 26 subversion 0) configuration:
   
  Platform:
    osname=linux
    osvers=4.4.0-72-generic
    archname=x86_64-linux-thread-multi
    uname='linux uchder 4.4.0-72-generic #93-ubuntu smp fri mar 31 14:07:41 utc 2017 x86_64 x86_64 x86_64 gnulinux '
    config_args='-des -Dprefix=/home/cpan/pit/thr/perl-5.26.0 -Dusethreads'
    hint=recommended
    useposix=true
    d_sigaction=define
    useithreads=define
    usemultiplicity=define
    use64bitint=define
    use64bitall=define
    uselongdouble=undef
    usemymalloc=n
    default_inc_excludes_dot=define
    bincompat5005=undef
  Compiler:
    cc='cc'
    ccflags ='-D_REENTRANT -D_GNU_SOURCE -fwrapv -fno-strict-aliasing -pipe -fstack-protector-strong -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64'
    optimize='-O2'
    cppflags='-D_REENTRANT -D_GNU_SOURCE -fwrapv -fno-strict-aliasing -pipe -fstack-protector-strong -I/usr/local/include'
    ccversion=''
    gccversion='5.4.0 20160609'
    gccosandvers=''
    intsize=4
    longsize=8
    ptrsize=8
    doublesize=8
    byteorder=12345678
    doublekind=3
    d_longlong=define
    longlongsize=8
    d_longdbl=define
    longdblsize=16
    longdblkind=3
    ivtype='long'
    ivsize=8
    nvtype='double'
    nvsize=8
    Off_t='off_t'
    lseeksize=8
    alignbytes=8
    prototype=define
  Linker and Libraries:
    ld='cc'
    ldflags =' -fstack-protector-strong -L/usr/local/lib'
    libpth=/usr/local/lib /usr/lib/gcc/x86_64-linux-gnu/5/include-fixed /usr/include/x86_64-linux-gnu /usr/lib /lib/x86_64-linux-gnu /lib/../lib /usr/lib/x86_64-linux-gnu /usr/lib/../lib /lib
    libs=-lpthread -lnsl -lgdbm -ldl -lm -lcrypt -lutil -lc -lgdbm_compat
    perllibs=-lpthread -lnsl -ldl -lm -lcrypt -lutil -lc
    libc=libc-2.23.so
    so=so
    useshrplib=false
    libperl=libperl.a
    gnulibc_version='2.23'
  Dynamic Linking:
    dlsrc=dl_dlopen.xs
    dlext=so
    d_dlsymun=undef
    ccdlflags='-Wl,-E'
    cccdlflags='-fPIC'
    lddlflags='-shared -O2 -L/usr/local/lib -fstack-protector-strong'


Characteristics of this binary (from libperl): 
  Compile-time options:
    HAS_TIMES
    MULTIPLICITY
    PERLIO_LAYERS
    PERL_COPY_ON_WRITE
    PERL_DONT_CREATE_GVSV
    PERL_IMPLICIT_CONTEXT
    PERL_MALLOC_WRAP
    PERL_OP_PARENT
    PERL_PRESERVE_IVUV
    USE_64_BIT_ALL
    USE_64_BIT_INT
    USE_ITHREADS
    USE_LARGE_FILES
    USE_LOCALE
    USE_LOCALE_COLLATE
    USE_LOCALE_CTYPE
    USE_LOCALE_NUMERIC
    USE_LOCALE_TIME
    USE_PERLIO
    USE_PERL_ATOF
    USE_REENTRANT_API
  Locally applied patches:
    Devel::PatchPerl 1.48
  Built under linux
  Compiled at May 31 2017 11:14:08
  %ENV:
    PERL5LIB=":/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/yAoe5PnQ1y/Array-Utils-0.5/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/yAoe5PnQ1y/Array-Utils-0.5/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jG_2KAufWf/IO-String-1.08/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jG_2KAufWf/IO-String-1.08/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9nTFSLMpYZ/Data-Stag-0.14/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9nTFSLMpYZ/Data-Stag-0.14/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/UFiAMQhT9D/Class-Data-Inheritable-0.08/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/UFiAMQhT9D/Class-Data-Inheritable-0.08/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/MB95d7iFrS/Devel-StackTrace-2.02/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/MB95d7iFrS/Devel-StackTrace-2.02/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Clw7edKudf/Exception-Class-1.43/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Clw7edKudf/Exception-Class-1.43/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/MqKJwsJ3l7/Test-Deep-1.127/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/MqKJwsJ3l7/Test-Deep-1.127/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/3wawmIqyum/Capture-Tiny-0.46/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/3wawmIqyum/Capture-Tiny-0.46/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/RQ6BqiXOBP/Algorithm-Diff-1.1903/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/RQ6BqiXOBP/Algorithm-Diff-1.1903/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/kXXvdTMqU9/Text-Diff-1.45/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/kXXvdTMqU9/Text-Diff-1.45/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/zofFeiKCzX/Test-Differences-0.64/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/zofFeiKCzX/Test-Differences-0.64/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9X92JSK1jw/Sub-Uplevel-0.2800/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9X92JSK1jw/Sub-Uplevel-0.2800/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/hnNOTiihl_/Test-Exception-0.43/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/hnNOTiihl_/Test-Exception-0.43/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ruWbdLDexU/Test-Warn-0.32/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ruWbdLDexU/Test-Warn-0.32/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jjuSxIzSCh/Test-Most-0.35/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jjuSxIzSCh/Test-Most-0.35/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efBZkFB86z/Test-Needs-0.002005/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efBZkFB86z/Test-Needs-0.002005/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/FQB1GHNv2V/URI-1.72/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/FQB1GHNv2V/URI-1.72/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/z5fLql5TTh/BioPerl-1.007001/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/z5fLql5TTh/BioPerl-1.007001/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/43LvCvo7ow/Encode-Locale-1.05/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/43LvCvo7ow/Encode-Locale-1.05/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/pof4tlM1WT/HTTP-Date-6.02/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/pof4tlM1WT/HTTP-Date-6.02/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/bkRwwnylMz/File-Listing-6.04/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/bkRwwnylMz/File-Listing-6.04/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/gLEUfkrGLl/HTML-Tagset-3.20/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/gLEUfkrGLl/HTML-Tagset-3.20/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ShpPyXhPi9/HTML-Parser-3.72/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ShpPyXhPi9/HTML-Parser-3.72/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/I1hEmFNWY9/IO-HTML-1.001/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/I1hEmFNWY9/IO-HTML-1.001/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/HtY4HQQYXx/LWP-MediaTypes-6.02/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/HtY4HQQYXx/LWP-MediaTypes-6.02/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Wb7u7rPGLI/Try-Tiny-0.28/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Wb7u7rPGLI/Try-Tiny-0.28/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/XTSyJRbrXU/HTTP-Message-6.13/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/XTSyJRbrXU/HTTP-Message-6.13/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/qf9w5Oya88/HTTP-Cookies-6.04/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/qf9w5Oya88/HTTP-Cookies-6.04/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/cCdNQ2OqWh/HTTP-Daemon-6.01/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/cCdNQ2OqWh/HTTP-Daemon-6.01/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/v1AuINkNNI/HTTP-Negotiate-6.01/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/v1AuINkNNI/HTTP-Negotiate-6.01/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/chJm9pRS8Q/Net-HTTP-6.17/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/chJm9pRS8Q/Net-HTTP-6.17/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Mzbs00VqAL/Test-Fatal-0.014/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Mzbs00VqAL/Test-Fatal-0.014/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/EATOiX85je/Test-RequiresInternet-0.05/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/EATOiX85je/Test-RequiresInternet-0.05/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/BGlj9lMm0S/WWW-RobotRules-6.02/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/BGlj9lMm0S/WWW-RobotRules-6.02/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/uo91VW72To/libwww-perl-6.26/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/uo91VW72To/libwww-perl-6.26/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/BLEFsQjpmC/Digest-MD5-File-0.08/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/BLEFsQjpmC/Digest-MD5-File-0.08/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/w4IdhuxZGt/Env-Path-0.19/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/w4IdhuxZGt/Env-Path-0.19/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/v4lQE6hPyQ/Number-Compare-0.03/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/v4lQE6hPyQ/Number-Compare-0.03/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/DmmBkkMmuT/Text-Glob-0.11/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/DmmBkkMmuT/Text-Glob-0.11/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/VKCkQCzPvO/File-Find-Rule-0.34/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/VKCkQCzPvO/File-Find-Rule-0.34/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/teAh9ZvRcu/File-Grep-0.02/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/teAh9ZvRcu/File-Grep-0.02/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/hr6a9PPaCE/Test-Warnings-0.026/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/hr6a9PPaCE/Test-Warnings-0.026/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/soXZ5Lfz7p/File-Slurper-0.009/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/soXZ5Lfz7p/File-Slurper-0.009/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Ul3Fd19hLr/File-Which-1.21/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Ul3Fd19hLr/File-Which-1.21/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/eFmsusDbKR/Graph-0.9704/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/eFmsusDbKR/Graph-0.9704/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/D0leUqJFbi/Parse-Yapp-1.21/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/D0leUqJFbi/Parse-Yapp-1.21/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/505dqBedmq/XML-Parser-2.44/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/505dqBedmq/XML-Parser-2.44/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/UfbKZ4To31/XML-Writer-0.625/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/UfbKZ4To31/XML-Writer-0.625/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/J75f61IecL/Graph-ReadWrite-2.09/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/J75f61IecL/Graph-ReadWrite-2.09/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ND0u4h19Po/Log-Log4perl-1.49/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ND0u4h19Po/Log-Log4perl-1.49/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/zLmD6ByVfS/Module-Runtime-0.015/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/zLmD6ByVfS/Module-Runtime-0.015/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/e1a6AZ8p2W/Dist-CheckConflicts-0.11/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/e1a6AZ8p2W/Dist-CheckConflicts-0.11/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jjp_3VIaMA/CPAN-Meta-Check-0.014/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jjp_3VIaMA/CPAN-Meta-Check-0.014/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/XjtD7Zz6kU/Params-Util-1.07/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/XjtD7Zz6kU/Params-Util-1.07/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9PakkP6l0R/Sub-Install-0.928/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9PakkP6l0R/Sub-Install-0.928/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/azR33pI4_5/Data-OptList-0.110/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/azR33pI4_5/Data-OptList-0.110/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/qWW1CEfYpU/Test-Requires-0.10/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/qWW1CEfYpU/Test-Requires-0.10/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/a3E8Tefju9/Module-Implementation-0.09/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/a3E8Tefju9/Module-Implementation-0.09/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/dIAF1bZnbf/Package-Stash-XS-0.28/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/dIAF1bZnbf/Package-Stash-XS-0.28/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/L3_7g8jfro/Package-Stash-0.37/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/L3_7g8jfro/Package-Stash-0.37/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/6yuZUtmLCh/Class-Load-0.24/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/6yuZUtmLCh/Class-Load-0.24/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/aP0ZLVRys2/Class-Load-XS-0.10/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/aP0ZLVRys2/Class-Load-XS-0.10/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/NZ4t9GgG3C/Sub-Exporter-Progressive-0.001013/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/NZ4t9GgG3C/Sub-Exporter-Progressive-0.001013/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Ppzgf_DwHW/Devel-GlobalDestruction-0.14/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Ppzgf_DwHW/Devel-GlobalDestruction-0.14/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/8AQnq1soT7/MRO-Compat-0.13/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/8AQnq1soT7/MRO-Compat-0.13/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/pNb6udRatM/Sub-Identify-0.14/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/pNb6udRatM/Sub-Identify-0.14/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/L4CSv85tPm/Devel-OverloadInfo-0.004/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/L4CSv85tPm/Devel-OverloadInfo-0.004/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/lKMYO88b94/Eval-Closure-0.14/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/lKMYO88b94/Eval-Closure-0.14/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Zh64wsXnxf/Module-Runtime-Conflicts-0.003/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Zh64wsXnxf/Module-Runtime-Conflicts-0.003/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/0XHp9ijWN6/Sub-Name-0.21/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/0XHp9ijWN6/Sub-Name-0.21/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/vbCadDRyZl/Package-DeprecationManager-0.17/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/vbCadDRyZl/Package-DeprecationManager-0.17/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/V0evX_VkWG/Sub-Exporter-0.987/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/V0evX_VkWG/Sub-Exporter-0.987/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/B3TnHrp82W/File-pushd-1.014/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/B3TnHrp82W/File-pushd-1.014/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/G1weerXMQR/Devel-Hide-0.0009/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/G1weerXMQR/Devel-Hide-0.0009/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/3vRtowQ63x/Variable-Magic-0.61/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/3vRtowQ63x/Variable-Magic-0.61/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/5oRNcg6PIu/B-Hooks-EndOfScope-0.21/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/5oRNcg6PIu/B-Hooks-EndOfScope-0.21/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/xhTtpZUCuQ/namespace-clean-0.27/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/xhTtpZUCuQ/namespace-clean-0.27/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/51z53C05TK/Test-CleanNamespaces-0.22/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/51z53C05TK/Test-CleanNamespaces-0.22/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/DVKcKr6_T_/Moose-2.2006/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/DVKcKr6_T_/Moose-2.2006/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/0RDB6_OB9o/PerlIO-utf8_strict-0.007/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/0RDB6_OB9o/PerlIO-utf8_strict-0.007/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/CoSa1mQHbc/Test-Files-0.14/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/CoSa1mQHbc/Test-Files-0.14/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/GUdg8HfqFW/Test-Output-1.031/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/GUdg8HfqFW/Test-Output-1.031/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/sjfmoDg5ad/Text-CSV-1.95/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/sjfmoDg5ad/Text-CSV-1.95/blib/arch:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/blib/lib:/home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/blib/arch"
    PERL5_CPANPLUS_IS_RUNNING="26471"
    PERL5_CPANPLUS_IS_VERSION="0.9168"
    PERL5_MINISMOKEBOX="0.68"
    PERL5_YACSMOKE_BASE="/home/cpan/pit/thr/conf/perl-5.26.0"
    PERL_EXTUTILS_AUTOINSTALL="--defaultdeps"
    PERL_MM_USE_DEFAULT="1"
  @INC:
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/yAoe5PnQ1y/Array-Utils-0.5/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/yAoe5PnQ1y/Array-Utils-0.5/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jG_2KAufWf/IO-String-1.08/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jG_2KAufWf/IO-String-1.08/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9nTFSLMpYZ/Data-Stag-0.14/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9nTFSLMpYZ/Data-Stag-0.14/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/UFiAMQhT9D/Class-Data-Inheritable-0.08/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/UFiAMQhT9D/Class-Data-Inheritable-0.08/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/MB95d7iFrS/Devel-StackTrace-2.02/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/MB95d7iFrS/Devel-StackTrace-2.02/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Clw7edKudf/Exception-Class-1.43/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Clw7edKudf/Exception-Class-1.43/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/MqKJwsJ3l7/Test-Deep-1.127/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/MqKJwsJ3l7/Test-Deep-1.127/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/3wawmIqyum/Capture-Tiny-0.46/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/3wawmIqyum/Capture-Tiny-0.46/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/RQ6BqiXOBP/Algorithm-Diff-1.1903/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/RQ6BqiXOBP/Algorithm-Diff-1.1903/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/kXXvdTMqU9/Text-Diff-1.45/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/kXXvdTMqU9/Text-Diff-1.45/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/zofFeiKCzX/Test-Differences-0.64/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/zofFeiKCzX/Test-Differences-0.64/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9X92JSK1jw/Sub-Uplevel-0.2800/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9X92JSK1jw/Sub-Uplevel-0.2800/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/hnNOTiihl_/Test-Exception-0.43/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/hnNOTiihl_/Test-Exception-0.43/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ruWbdLDexU/Test-Warn-0.32/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ruWbdLDexU/Test-Warn-0.32/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jjuSxIzSCh/Test-Most-0.35/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jjuSxIzSCh/Test-Most-0.35/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efBZkFB86z/Test-Needs-0.002005/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efBZkFB86z/Test-Needs-0.002005/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/FQB1GHNv2V/URI-1.72/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/FQB1GHNv2V/URI-1.72/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/z5fLql5TTh/BioPerl-1.007001/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/z5fLql5TTh/BioPerl-1.007001/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/43LvCvo7ow/Encode-Locale-1.05/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/43LvCvo7ow/Encode-Locale-1.05/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/pof4tlM1WT/HTTP-Date-6.02/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/pof4tlM1WT/HTTP-Date-6.02/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/bkRwwnylMz/File-Listing-6.04/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/bkRwwnylMz/File-Listing-6.04/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/gLEUfkrGLl/HTML-Tagset-3.20/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/gLEUfkrGLl/HTML-Tagset-3.20/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ShpPyXhPi9/HTML-Parser-3.72/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ShpPyXhPi9/HTML-Parser-3.72/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/I1hEmFNWY9/IO-HTML-1.001/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/I1hEmFNWY9/IO-HTML-1.001/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/HtY4HQQYXx/LWP-MediaTypes-6.02/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/HtY4HQQYXx/LWP-MediaTypes-6.02/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Wb7u7rPGLI/Try-Tiny-0.28/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Wb7u7rPGLI/Try-Tiny-0.28/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/XTSyJRbrXU/HTTP-Message-6.13/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/XTSyJRbrXU/HTTP-Message-6.13/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/qf9w5Oya88/HTTP-Cookies-6.04/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/qf9w5Oya88/HTTP-Cookies-6.04/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/cCdNQ2OqWh/HTTP-Daemon-6.01/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/cCdNQ2OqWh/HTTP-Daemon-6.01/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/v1AuINkNNI/HTTP-Negotiate-6.01/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/v1AuINkNNI/HTTP-Negotiate-6.01/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/chJm9pRS8Q/Net-HTTP-6.17/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/chJm9pRS8Q/Net-HTTP-6.17/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Mzbs00VqAL/Test-Fatal-0.014/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Mzbs00VqAL/Test-Fatal-0.014/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/EATOiX85je/Test-RequiresInternet-0.05/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/EATOiX85je/Test-RequiresInternet-0.05/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/BGlj9lMm0S/WWW-RobotRules-6.02/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/BGlj9lMm0S/WWW-RobotRules-6.02/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/uo91VW72To/libwww-perl-6.26/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/uo91VW72To/libwww-perl-6.26/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/BLEFsQjpmC/Digest-MD5-File-0.08/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/BLEFsQjpmC/Digest-MD5-File-0.08/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/w4IdhuxZGt/Env-Path-0.19/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/w4IdhuxZGt/Env-Path-0.19/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/v4lQE6hPyQ/Number-Compare-0.03/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/v4lQE6hPyQ/Number-Compare-0.03/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/DmmBkkMmuT/Text-Glob-0.11/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/DmmBkkMmuT/Text-Glob-0.11/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/VKCkQCzPvO/File-Find-Rule-0.34/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/VKCkQCzPvO/File-Find-Rule-0.34/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/teAh9ZvRcu/File-Grep-0.02/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/teAh9ZvRcu/File-Grep-0.02/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/hr6a9PPaCE/Test-Warnings-0.026/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/hr6a9PPaCE/Test-Warnings-0.026/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/soXZ5Lfz7p/File-Slurper-0.009/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/soXZ5Lfz7p/File-Slurper-0.009/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Ul3Fd19hLr/File-Which-1.21/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Ul3Fd19hLr/File-Which-1.21/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/eFmsusDbKR/Graph-0.9704/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/eFmsusDbKR/Graph-0.9704/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/D0leUqJFbi/Parse-Yapp-1.21/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/D0leUqJFbi/Parse-Yapp-1.21/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/505dqBedmq/XML-Parser-2.44/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/505dqBedmq/XML-Parser-2.44/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/UfbKZ4To31/XML-Writer-0.625/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/UfbKZ4To31/XML-Writer-0.625/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/J75f61IecL/Graph-ReadWrite-2.09/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/J75f61IecL/Graph-ReadWrite-2.09/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ND0u4h19Po/Log-Log4perl-1.49/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/ND0u4h19Po/Log-Log4perl-1.49/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/zLmD6ByVfS/Module-Runtime-0.015/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/zLmD6ByVfS/Module-Runtime-0.015/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/e1a6AZ8p2W/Dist-CheckConflicts-0.11/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/e1a6AZ8p2W/Dist-CheckConflicts-0.11/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jjp_3VIaMA/CPAN-Meta-Check-0.014/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/jjp_3VIaMA/CPAN-Meta-Check-0.014/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/XjtD7Zz6kU/Params-Util-1.07/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/XjtD7Zz6kU/Params-Util-1.07/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9PakkP6l0R/Sub-Install-0.928/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/9PakkP6l0R/Sub-Install-0.928/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/azR33pI4_5/Data-OptList-0.110/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/azR33pI4_5/Data-OptList-0.110/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/qWW1CEfYpU/Test-Requires-0.10/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/qWW1CEfYpU/Test-Requires-0.10/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/a3E8Tefju9/Module-Implementation-0.09/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/a3E8Tefju9/Module-Implementation-0.09/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/dIAF1bZnbf/Package-Stash-XS-0.28/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/dIAF1bZnbf/Package-Stash-XS-0.28/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/L3_7g8jfro/Package-Stash-0.37/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/L3_7g8jfro/Package-Stash-0.37/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/6yuZUtmLCh/Class-Load-0.24/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/6yuZUtmLCh/Class-Load-0.24/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/aP0ZLVRys2/Class-Load-XS-0.10/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/aP0ZLVRys2/Class-Load-XS-0.10/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/NZ4t9GgG3C/Sub-Exporter-Progressive-0.001013/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/NZ4t9GgG3C/Sub-Exporter-Progressive-0.001013/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Ppzgf_DwHW/Devel-GlobalDestruction-0.14/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Ppzgf_DwHW/Devel-GlobalDestruction-0.14/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/8AQnq1soT7/MRO-Compat-0.13/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/8AQnq1soT7/MRO-Compat-0.13/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/pNb6udRatM/Sub-Identify-0.14/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/pNb6udRatM/Sub-Identify-0.14/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/L4CSv85tPm/Devel-OverloadInfo-0.004/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/L4CSv85tPm/Devel-OverloadInfo-0.004/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/lKMYO88b94/Eval-Closure-0.14/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/lKMYO88b94/Eval-Closure-0.14/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Zh64wsXnxf/Module-Runtime-Conflicts-0.003/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/Zh64wsXnxf/Module-Runtime-Conflicts-0.003/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/0XHp9ijWN6/Sub-Name-0.21/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/0XHp9ijWN6/Sub-Name-0.21/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/vbCadDRyZl/Package-DeprecationManager-0.17/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/vbCadDRyZl/Package-DeprecationManager-0.17/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/V0evX_VkWG/Sub-Exporter-0.987/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/V0evX_VkWG/Sub-Exporter-0.987/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/B3TnHrp82W/File-pushd-1.014/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/B3TnHrp82W/File-pushd-1.014/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/G1weerXMQR/Devel-Hide-0.0009/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/G1weerXMQR/Devel-Hide-0.0009/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/3vRtowQ63x/Variable-Magic-0.61/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/3vRtowQ63x/Variable-Magic-0.61/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/5oRNcg6PIu/B-Hooks-EndOfScope-0.21/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/5oRNcg6PIu/B-Hooks-EndOfScope-0.21/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/xhTtpZUCuQ/namespace-clean-0.27/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/xhTtpZUCuQ/namespace-clean-0.27/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/51z53C05TK/Test-CleanNamespaces-0.22/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/51z53C05TK/Test-CleanNamespaces-0.22/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/DVKcKr6_T_/Moose-2.2006/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/DVKcKr6_T_/Moose-2.2006/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/0RDB6_OB9o/PerlIO-utf8_strict-0.007/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/0RDB6_OB9o/PerlIO-utf8_strict-0.007/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/CoSa1mQHbc/Test-Files-0.14/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/CoSa1mQHbc/Test-Files-0.14/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/GUdg8HfqFW/Test-Output-1.031/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/GUdg8HfqFW/Test-Output-1.031/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/sjfmoDg5ad/Text-CSV-1.95/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/sjfmoDg5ad/Text-CSV-1.95/blib/arch
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/blib/lib
    /home/cpan/pit/thr/conf/perl-5.26.0/.cpanplus/5.26.0/build/efL4bZUUGq/Bio-Roary-3.10.0/blib/arch
    /home/cpan/pit/thr/perl-5.26.0/lib/site_perl/5.26.0/x86_64-linux-thread-multi
    /home/cpan/pit/thr/perl-5.26.0/lib/site_perl/5.26.0
    /home/cpan/pit/thr/perl-5.26.0/lib/5.26.0/x86_64-linux-thread-multi
    /home/cpan/pit/thr/perl-5.26.0/lib/5.26.0